-
0:00/3:17
“What’s the matter darling? You don’t seem yourself.”
The woman in the breakfast scene asked the question. The man in the breakfast table starts to answer it.
“I’m………………..”
In Biology books scientists tell us that the nerve impulse travels down neurones towards a target gland, muscle or organ, leaping synapses on the way, making connections and missing others. A job to do and nothing but that job to do. So as the woman’s question echoes around the chambers of his mind, the man’s impulse enters into any park, in any town, in any land and heads towards an answer. A job to do and nothing but that job to do.
Four seconds.
SECOND ONE
In the park a man in a long black coat with evangelical leanings and a hint of mischief in his gait, approaches Theman Simpulse.. Why this time? Theman had sensed him before on many occasions, a presence but an intangible, a shadow just out of sight hiding in the back of his mind. The Man in The Long Black Coat had always however kept his distance from Theman for whatever reason but now here he was thundering across the park from out of the trees with the air of a demonic priest. He took Theman by the elbow and turned him.
“Do you believe in the fire in your soul?”
He felt the man’s frustration.
“Do you believe in the fire in your soul?” He repeated his castigation with added vehemence.
Theman had been waiting for this moment. A moment he’d kept pushing away and avoiding. A moment he knew he had to at some time face and deal with but one he’d never wanted to. Theman’s world had always been dealt with by creating an external shield. A persona mask that he put around himself to protect him from anything that could potentially hurt or upset him but this question from the man in the long black coat had in an instant stripped this mask of its power and laid Theman bare. He now stood where he knew he really always had been, inside his skin, claustrophobic and aimless.
He realised immediately that he had for too long actually become his mask and not separated himself from it. This had been what was causing the damage he was starting to feel in his life.
“I am but a set of contradictions which I have never been able to approach, let alone unravel and now I stand at the start of the need to do so.With one foot hanging in the freefall and the other earthtight and gripped, what will be my way?”
The voice of logic demanded its answer.
The moment of choice had already happened many times before so there was really no choice other than the need not to make one.
Theman let go and found himself in a place of uncomfortable void, not one thing or the other, not here nor there, not him or nohim. He allowed himself to be in the void and let go again into a tunnel which appeared in front. This had an aspect of clean and mutant peace which bathed Theman for a moment in something he felt from the past, something almost heroic that hinted at what was to be. And there he was flying high above the secondary spirit, Theman adoring his disorientation, embracing his confusion and letting his spirit rise and fall in the skies above the mutating earth below.
No friction, no atmosphere, no stopping, no breaks, no thoughts, no perception, just a flight to a landing on a column of intruding rock bursting up from under the surface below to catch him in his destiny. He stands in a horse stance on his column and watches the Re-Creation Day below from humble beginnings grow. Standing as the first man on the brink of awareness, his way started to settle in front of him, Theman saw it all. No mask, no shields, just Theman bare and un-tethered. He felt as a God above his growing creation appearing all around himself. He had embraced his fears, unravelled the illusions that had been running his life and stood now alone and omnipotent surveying all that was, is and will be his.
But Theman had a doubt, as all Gods do, which dragged him back to his masks and shields.
“Has this all been truly independent? Am I really the master of my destiny?”
The doubt clattered at his feet, echoing its litigations around Theman’s previously virginal and all-encompassing new world.
“He asked the question ‘Do you believe in the fire in your soul?’. He wanted me to start to build a bridge to my new world. Did I?”
The doubt started to grow.
His newfound independence had brought a twist in the tail along with it. A caveat that demanded something a little more challenging for Theman. He had a new journey to start.
SECOND TWO
ATCGCGTAATGCGCATATATCGGCGCGCGCATTATATA
CGCGCGTAATTACGATATCGCGTAGCGCTAATCGGCCG
The relentless tapping of the letters filled the scene. A back drop of themed structure greeting the slowly growing chant that faded in from the background
“Into the ladder you go Theman
Into the Codeyyou
Into the search for the essence of It
Into the Codeyyou”
The words surrounded Theman Simpulse as he surfed mercurially through strand after strand of his own D.N.A.
Adenine to Thymine; Cytosine to Guanine; Thymine to Adenine; Guanine to Cytosine.
The eternal pairs.
He watched their combinations shine through his spirals that twisted way off into the distance. Diving in and out through the rungs of the codeyyou, he let the chant diffuse with its pervasiveness, its rhythm vibrating and probing with its insistent beat into Theman’s moment. He watched the D.N.A. creating its messages and sending them out making Theman Theman and he wondered, as he flew through the myriad of images, what he was, what he had been and what he was going to become. Where did these messages come from, where were they going and why was it all happening?
He started to sense an idea.
Process, never ending process, eternity in action.
As if on cue the section of D.N.A. in front of him started to unravel itself; Adenine from Thymine; Cytosine from Guanine; Thymine from Adenine; Guanine from Cytosine; a ladder being pulled apart from the bottom straight up through the centre of the rungs. The two halves of the ladder flailed either side of Theman as he surfed up through the centre of them. Life marches on. As he flew past, the flailing Adenines cried out for new Thiamines and they came, as babies to their mother. New Cytosines flew to Guanines and new Guanines to Cytosines. They joined, a masterful union, new possibilities, a symphony unfolding. The heroic onward march spiralling astride the duality, underneath the never-ending interplay of opposites. Theman heard the question again.
“What’s the matter darling? You don’t seem yourself.”
Yourself ? Theman lay on an Adenine, carbon and nitrogen entwined. Your Self. Your Self. Your Self. Your Self ?
“Into the ladder you go Theman
Into the codeyyou
Into the search for the essence of It
Into the codeyyou”
He cradled the Adenine and Thymine together as they found their place. He was the third that hinted at the fourth. A God with doubt is a God indeed and a God indeed creates and is created by the process that lies within and without. The spinning of nothingchaos has a stillness that speeds through space and time with no destiny other than that destiny that awaits it. Theman felt a glimpse of something slide from his grasp as he let the ideas come and go
First Idea
In the corner of the stone room sits a hanging head man. The hanging head man was blank. His mind has been used against his will. Used and taken for a while without his permission. Where it was taken, he did not know which made it worse. He just knew that for some period of time his mind had not been his. It now felt different. Antiseptic, numb, frayed and forgotten. And there was a terror as well. A lonely terror which hung over him threatening to take the mind for good. It felt loose, out of control, autonomous function wild, not free.
The hanging head man stood up and walked to the opposite side of the room. His body felt dislocated, his legs not his. A dizziness pervaded. He slumped down against the opposite wall did the hanging head man. Flashing images of concrete appeared. Harsh urban edges. Regular rectangular hard teeth crack concrete embedded no fracture. There is no movement. Grey to the touch and the smell. Switch flashframe plastic bucket new smell. New smell bleach? New smell new smell. No history new. No story just new smell. An analogy of nothing. No thing. New smell, new smell. No anticipation, no growth, no life. Just new smell.
If the hanging head man had mathematized at that point, he would have been an unbalanced cross ready to fall, a slow looping fall. He would have felt no movement, felt no conflict, felt no, no felt. The taking of his mind had caused this. Its illegal use had cut off the top of that cross. He no longer had the ability to let himself emote. A large dark shadow stood between him and that freedom. A shadow which shifted whichever way he turned.
Distant memories hinted at something but an intangible. Stills of a life devoid. Images of Mother, Father. Mother familiar but nothing for the heart to devour. Just a distant mammary. Images that lay stacked inert piled thousands one after the other on top of each other.
“What is a feeling?” asked the hanging head man.
“The opposite of thinking,” said the voice.
“Do I need to stop thinking to feel?” asked the hanging head man.
“Yes,” confirmed the voice.
The hanging head man stood up and slouched back over to the other side of the room. He ran his hands over the rendered wall. Granular smooth limestone based. Sodium Carbonate. Stop. Primordial swamp. I am not solid. Was this the start of repair? Theman let the idea pass on. The second flew in like a wild horse.
Second Idea
The blank canvas of myself is laminate thick and betraying in its plain basic ness. “The confusion underlying the waiting brush is huge and makes me who I am,” says the wrinkled-up woman with a bowl for a face. But the wrinkled-up woman with a bowl for a face doesn’t know who I am because that is left to the artists from the past to decide. They throw and stick their ideas to me at will and they have no plan either. I feel as something that rides oblivious through the fleeting fields of time and catches only a semblance of what I am from blurring points flying at me; outside references that come and go as dreams and leave traces, retinal imprints bereft of focus, welcome strangers who hint at hidden treasures.
And so I ride on through the onslaught catching bullets in my teeth, backwards somersaults to the crowd and all the time my smile glistens concrete set in the mask that floats in front of my face. Through the colourful villages, down……….
Idea three took Theman back to God and his creations.
Third Idea
One day on the seabed there was a confused catfish. Now when I say confused, I mean confused. All day long her mind just would not settle on anything. If she tried to do a simple task like making some toast in the morning, she would end up putting the bread in the washing up bowl and the knife that she was going to spread the butter with, in the toaster. If she tried to read a book, she would sit there with it upside down for half an hour and not realise she had been holding it that way and then still wonder why she had not been able to follow the plot of the story. If she had friends round for dinner she would more often than not forget that she had invited them and then have to hide in the cupboard under the stairs until they had stopped ringing the doorbell and had gone away. Every minute of the day something would go wrong. She just could not keep her mind on anything. Anything that is other than that Thought that was stopping her thinking of anything else that she tried to think of other than that Thought that was causing any other thoughts that tried to be thought of from staying in her mind as a thought.
You’ll probably find it easier to understand if you look at it like this. You know when you wake up in the morning and you might be in a bad mood and there is no real reason for it? Or you may wake up with a fantastic idea and not really know where it’s come from? Or you may even wake up full of the joys of life and want to jump out of bed and run around hugging everybody and still not really know why? Well, a few months back, the confused catfish had one of these and it was immense. She woke up with this Thought in her head and it has been there ever since. It had come out of nowhere. She hadn’t seen anything on television about it. She hadn’t heard anything on the radio. She was sure it had never come up in any conversation she had ever had with anyone. It had just appeared. It was as if it had seeped up from inside her pillow in the middle of the night, climbed in through one of her gills and manacled itself tightly around everything that made her what she was. Prior to this fateful morning, she had been the complete opposite of a confused catfish; more like a competent, calculating and completely in control catfish. But this Thought had put an end to that once and for all. She’d become a complete mess. A catfish caught in a conundrum of chaos and confusion cascading out of control caused by her need to consider.....
WHY ARE WE CALLED CATFISH WHEN WE WERE HERE LONG BEFORE CATS? THEY SHOULD BE NAMED AFTER US; NOT US AFTER THEM!!
And once that question had appeared, her life was filled with nothing else other than that. It was the unfairness of it all that got to her the most. It is a well-known fact that the fish were put into the oceans by The One That Made All This Stuff long before anything was put onto the land. It followed on from this therefore that the catfish had been around before the cats. So how had it happened that the cats had given their name to the catfish and not the other way around?
It just didn’t make sense to the confused catfish, and she wouldn’t leave it alone. In fact, it was more like couldn’t leave it alone. It is a well-known fact on the seabed that a catfish is generally of a determined, thoughtful disposition and this was most definitely coming through in the confused catfish’s case. But unfortunately, as we have just heard, the fact she was thinking so much about this problem had started to interfere with her life to the point where it was almost causing it to collapse. However, collapse it would not. Her determination was the part of her character that was to save her. The determination to find out the truth about the naming of catfish and cats and to discover how such a travesty of justice, as she saw it, had ever been allowed to happen.
One morning, after she’d cleaned her teeth with the soap and spread toothpaste over herself in the shower, the confused catfish decided enough was enough. The question needed an answer before it completely took over her world and drove her into madness. So she decided it was time to find it. She started with a phone call to her friend, the corrupt catfish, who was the M.P. for the local area. He had a few contacts up on the land and that’s where the confused catfish knew she would have to go to sort this whole affair out. He was very helpful. Within half a day he had arranged a court case up on the surface presided over by none other than Chief Justice Judge Supremo Generally Pretty Important Bloke Chutney Senior himself. This was a major coup because Judge Chutney had been the chief judge on the famous Beached Whale case of 1953. You must remember the one! It was when the workshy whale had been sunbathing up on the beach and some local humans took it, without asking her, that she was in distress and tried to crane-lift her back into the sea. She rolled in temper into the crane, totally destroying it. They then decided that she was sun-crazed and that she needed to be taken straight to hospital. And it all went off from there. I’m sure you remember it now. Well, Judge Chutney was the one who made that now famous comment in the summing up at the end of the case.
“If a whale wants privacy
then why not let it be.”
Eleven words that were to change the whole relationship between the folk on the seabed and the people on the surface. But that’s another story.
The corrupt catfish had also got onto his contacts at the newspapers, both on the seabed and up on the land. He had informed them of this huge court case that was starting the next day, which would be addressing a possible fundamental mistruth that had been lurking around for millions and millions of years. He had told them about this inherent problem of the naming of catfish and cats and had inferred that there may even be a possibility of a discovery of a mistake having been made by The One That Made All This Stuff. The journalists, reporters, photographers and anybody else who worked on the papers streamed out of the pubs, bars and restaurants, when they heard this news, and headed straight down to Chutney Chambers, trying to get prime position for when the case started first thing in the morning.
The sight outside the courthouse, at just before nine ‘o’clock the next day, was amazing. Chutney Chambers had never seen anything like it before. All the way along the edge of the beach, which ran past the front of the building, hundreds and hundreds of catfish were positioned half in and half out of the water. Some were standing up full length on their tails clapping their fins together. Others were rolling from side-to-side cheering and shouting the confused catfish’s name at the top their voices. A few had somehow even managed to slide their way in pairs up some of the telephone poles that lined the seafront and were busy waving catfish flags and blowing catfish horns in the direction of the promenade that passed in front of the courthouse.
All the way along the length of this promenade was where the cats had gathered. Hundreds and hundreds of them. From Persians to Tabbies, from Siamese to Russian Blues. Every sort of cat you could think of. That part of the seafront was absolutely jammed packed with them. Some were up on the walls shaking their bums and farting in the direction of the catfish. Others were simply stalking their way across the top of the huge brick wall that overlooked the beach, just sneering their contempt at the fish below them. As well as this, at either end of the promenade, two groups of about twenty cats had got together and were screeching and miaowing, as loud as they could, a chant that echoed around the whole bay.
“Catfish, catfish that’s your name
You’re never gonna change it, what a shame!”
The words seemed to be flying out, bouncing off the surrounding cliffs and then returning only to meet the next lot coming flying forward again. This was creating a huge cauldron of noise which, together with the din the catfish were making with their horns and cheers, was becoming near tounbearable.
Almost drowned out by all the racket filling the little bay, the huge gothic clock above Chutney Chambers started to strike the hour of nine. Exactly at the same time in the far distance, right at the end of the seafront, appeared a most peculiar looking procession. On first seeing it you would have thought it was a funeral cortege or something like that but as it drew closer you could see that it wasn’t. It was the confused catfish. She was in a tank of water on a wooden platform being carried by four policemen and she looked very, very nervous. As they reached the doors of the courthouse, the coppers had to stop and put the tank down for a few seconds to turn it around so they could walk it straight in through the huge wooden doors that led into The Chambers themselves.
It was the moment all the cats had been waiting for. With the chants and the screeching and miaowing reaching a new level of loudness, they rushed at the fish tank hurling abuse, a few stones and whatever else they could get their paws on, as they went. The policemen, realising they were hopelessly outnumbered, just put their heads down and started to run up the stone steps towards the doors ahead of them as fast as they could. They were never going to make it though. As you know cats are fast and four policemen carrying a confused catfish in a water filled tank on a sturdy wooden platform, are not. The cats drew closer, spitting and screaming abuse at the lumbering procession in front of them. Then a piece of catfish folklore took place. Something that would be spoken about in the catfish world for years and years to come.
Two courageous catfish, seeing what was about to happen, had managed, by a mixture of luck, expert rope swinging and pure bravado, to make their way across to the telephone pole closest to Chutney Chambers. Down below them they could see the tank and the tops of the policemen’s helmets moving passed up the steps and drawing closer, just a few steps behind, they could see the cats. The two courageous catfish didn’t really seem to have time to think; they just did it. One of them held the rope as tightly as he could between his fins and the other bungee jumped down towards the ground. Whether they had planned it or whether it was just pure luck, nobody ever really found out; but in any respect it was perfect. The jumping catfish stopped just a couple of centimetres short of the steps, swinging from side to side. He made his face as big as he could, puffed up his lips and at the top of his voice bellowed: “STOP!”
The cats were so shocked by the sight in front of them that they all, to a moggy, pulled up to a standstill, not really being sure what to do next. This hesitation gave the confused catfish and the coppers just enough time to get to the top of the steps, in through the wooden doors and to the relative safety inside. Meanwhile outside, the catfish at the top of the pole had started pulling for all he was worth, lifting his friend up away from the leaping mass of absolutely furious cats below, who were screaming out, into the sky, for retribution and revenge.
Inside Chutney Chambers the atmosphere could not have been more different. As the policemen carried the confused catfish through to the main courtroom, the noise from outside gradually disappeared to be replaced by a padded silence, similar to that inside a library or museum reading room. They placed the tank on a podium situated in front of The Bench and just sat down waiting silently for something to happen. The confused catfish took the chance to have a look around. There was nobody else there apart from the five of them and an insignificant looking man sitting across the other side of the room on a stool, nervously fiddling with the sleeve of his jacket. The confused catfish looked back up at The Bench.
“Please be standing.”
In the time she had been looking around the courtroom a huge guppy, bulldog of a man had taken his seat in front of them. He was an imposing figure wearing a gown, a judge’s wig and a most self-satisfied look on his face. It was Chief Justice Judge Supremo Generally Pretty Important Bloke Chutney Senior himself. The coppers and the insignificant man leapt to their feet immediately.
“So begins the case concerning the possible renaming of the catfish and the cat.”
His voice echoed around the courtroom.
“Please be seated.”
The five of them all sat down.
“Not you!”
His voice thundered across the room at the insignificant man.
“You can stay standing up until you’ve said what you’ve got to say and then you can go.”
The insignificant man seemed to visibly shrink under the onslaught of the Judge’s voice. Judge Chutney glanced down towards the confused catfish in her tank and smiled.
“Don’t worry darling. This won’t take long.”
The confused catfish nodded her head slowly and stayed quiet.
Judge Chutney carried on, scowling across at the insignificant man.
“Right! Hurry up with it. Tell her who you are. Tell her what you’ve cocked up and then we can get this all sorted out and go down the pub. Come on! Get a move on!”
The insignificant man looked over at the confused catfish and started to speak. And what he proceeded to tell her...! Well, what he told her was a one off! A first! A cataclysmic event! He introduced himself as The One That Made All This Stuff and explained to her how he had created the world and everything that had been, was or would be on it. He told her how it had been ok for a time but that after a while the strain of it had started to tell and that he just needed to get away. He explained how he had disappeared for a holiday on one of those last-minute budget beach deals you can get from a travel agent’s on the High Street. And he admitted that he had made The Mistake while he had been away, lounging around eating ice cream by the swimming pool.
Judge Chutney interrupted.
“Well! Explain to her exactly what this mistake was, you idiot!”
The One That Made All This Stuff looked apologetically over at the confused catfish.
“Because I was going on holiday I forgot to give your species a name. I’d made you the night before I left but I was in such a hurry to get away in the morning I just forgot to call you anything.”
The One That Made All This Stuff looked as if he was on the point of starting to cry.
“Yes and, and, and, and..... Get to the point! Tell her what you ended up doing then. We haven’t got all day!”
Judge Chutney glared across the room, tapping the face of his watch at The One That Made All This Stuff.
“When I got back from the holiday, I realised the mistake I had made and tried to put it right. I knew your species needed a name and, in the meantime, whilst away, I had created the cats in a moment of boredom one morning in the shower. I saw that you both had whiskers so I thought it would make sense to name yourselves after the cats. Hence catfish and cat. I know you were made before the cats and therefore shouldn’t really have been named after them but, up until now, it didn’t really seem to matter. The mistake had been made, passed over and everything seemed to be ok.”
“Well, it isn’t, is it?” interrupted Judge Chutney.
The One That Made All This Stuff shook his bowed head.
“Well. Tell her what you’ve decided to do then.”
“After Judge Chutney called me up yesterday and told me what had happened, it jogged my memory and I remembered, out of nowhere, what I had originally decided to call your species way, way, way before any of this occurred. Everything had a name before I’d even started to think about creating the earth you know. I just needed to make sure I gave the right name to the right species.”
“For crying out loud man! Tell her what’s going to happen. I need a drink.”
Judge Chutney slammed his fist down on The Bench.
The One That Made All This Stuff carried on to explain that right from Day One, the catfish, one of the first species, should really have been known as the Slinkfish. That from now on they would be and, as a kind of balancing up needed to happen, cats would no longer be known as Cats but would be called Slinks after the Slinkfish. Which when you think about it is really a much better name for them, isn’t it?
Theman chuckled to himself as he let the catfish story fly off towards the Cytosine Guanine rung in front of him. The tale twisted and turned itself and started to mingle its words in between the chemical bonds of the nitrogens and carbons that danced in rings inside the pair. The letters seemed to roll onto the outside of the atoms and make new connections and structures that grew with each different sentence from the story as it entangled itself in and around, up and over and in between this part of Theman’s DNA.
Lumps of fresh message flew from the pair as these new structures created more pathways and a myriad of fresh possibilities. The messages hurtled off into the distant membranous space that lay all around. Theman felt the next idea nudge in from the side.
Fourth Idea
“What do you want?”
The question took Theman to the inside of the Idea and sat him down.
He found himself alone, sitting halfway up in a lecture theatre. No windows. Polished wood and carpet.
“What do you want?”
The repeat of the question, with its added insistence, took Theman’s attention this time to the solitary figure, seated in a chair on the stage at the front.
He stood and repeated the question for a third time.
Theman felt his own voice, small and insignificant, leave his head.
“I don’t understand what you mean.”
The Theman who’d been high above his New World on Recreation Day, a God incarnate, now seemed an eternity away. He suddenly felt minute. Pre God. Alone and cold. Back again at that point of indecision that had filled his being as the priest in the park had barked his accusing question.
“Do you believe in the fire in your soul?”
The Man at The Front fixed Theman with a glare.
“Where is your fire Theman? Was it yours as you stood high above the genesis at your feet? Was it burning inside you as you surveyed your own omnipotent universe? I don’t think so. Do you? Why the doubt Theman? Why the doubt? Because after all you are the master of your own destiny. Aren’t you Theman? Well, you are. Aren’t you?”
He felt the indecision, that had plagued him from the moment of his wife’s question, flow back inside as a dark poisoned mindmist settled over his soul once again.
Suddenly The Man at The Front leapt to his feet and started a looping dance across the front of the stage, accompanied by a slow waltzing chant that echoed around the empty spaces in the auditorium. He pointed his mocking index fingers in a synchronistic rhythm, prodding and poking outwards and firing the words like arrows at Theman.
“The tiniest thing in the Universe, the tiniest thing that’s me
The tiniest thing in the universe, I’m just beginning to see.
The tiniest thing in the Universe, the tiniest thing that’s me
The tiniest thing in the universe, I’m just beginning to see”
The chant continued over and over, round and round until the lecture theatre was awash with the mantra. Theman could feel himself bristle with every repetition. The words hit cold into his soul with their mocking driving insistence and their barren knowhow.
“The tiniest thing in the Universe, the tiniest thing that’s YOU!”
The Man at The Front stood motionless, smirking, both hands dramatically aimed at Theman. The silence in the room, without the chant and the shuffle of his ungainly dance, was immense but the truth in the mantra had been just too much.
“What do you want?”
Theman could no longer disguise his anger and frustration. The five words screamed from his mouth across the gap between the two men.
The Man at The Front pulled another chair onto the stage.
“Thank goodness for that. I want to explain something to you. Why don’t you come and have a seat?”
A one-way traffic of words.
“You have been sent on a journey, as you know, to answer a question. “What’s the matter darling? You don’t seem yourself.” So far in your quest, you have experienced indecision in the park, a moment of limbo in The Clean and Mutant Peace Tunnel and then made a leap forward into what you at first thought was an immediate answer. You experienced this answer as a new creative initiative, watching it grow high above an unfolding landscape of virginal possibilities and rebirth. You took this immediacy as a God would and then held it to your soul as an ultimate truth. This brought with it the damning paradox. God meeting ultimate truth? Every God has an aberration. A need to repair. A final realisation of incompleteness. Yours came when you accepted, in your moment of deification, that you had not reached it independently. The bridge forward was not wholly yours. That moment of doubt was enough. The answer still lies within and how more ‘within’ can you get than your own D.N.A? And here you are.”
“Into the ladder you go Theman
Into the codeyyou
Into the search for the essence of It
Into the codeyyou”
The Man at The Front smiled at Theman.
“The essence of It. Where does that lie, I wonder? You knew or sensed intuitively, as you watched your own strands of D.N.A. replicate, what your codeyyou is doing and what your role in this part of the process is. You are at the moment acting as a kind of antenna which draws the ideas towards you. You direct them into the pairs of D.N.A. bases where they work their magic. The ideas actually alter what your codeyyou is and what it’s doing. In their world the scientists call this a mutation. They have identified toxic chemicals, viruses and various types of radiation that do the same but as yet they haven’t spotted The Idea option. That’s probably down for the priests and holy men and women amongst them to discover!”
The Man at The Front laughed out loud, a little too loud perhaps, and shifted himself forward in his chair, fixing Theman with a peculiar stare.
“I wonder when they will spot it. It seems obvious really. Have a look at what The Idea about the hanging head man did.”
The Man at the Front held his hands in a ball shape and Theman looked in.
The last words of the hanging head man Idea swirled around in front of him. Granular smooth limestone based. Sodium Carbonate. Stop. Primordial swamp. I am not solid. Was this the start of repair? Granular smooth limestone based. Sodium Carbonate. Stop. Primordial swamp. I am not solid. Was this the start of repair?
Some words from earlier on in the same Idea lay behind these like a view through a net curtain. And there was a terror as well. A lonely terror which hung over him threatening to take the mind for good. It felt loose, out of control, autonomous function wild, not free. And there was a terror as well. A lonely terror which hung over him threatening to take the mind for good. It felt loose, out of control, autonomous function wild ,not free.
He could see the letters from the words behind the net curtain surrounding the carbon and nitrogen atoms that made up the Adenine and Thymine in his own D.N.A. They were bombarding them like feeding birds at sea, breaking the bonds between them, damaging them, destroying their structure. The messages that this part of his D.N.A. were creating and sending out into the cytoplasmic workshops around his body were warped, asymmetrical and non-functional.
He looked in front of the curtain and saw the opposite happening. The words from this part of the idea were trying to repair the damage. The letters from the words ‘not solid’ and ‘start of repair’ were entwining themselves around the damaged parts of the DNA and creating new bonds, pulling the molecules together and causing the ‘right’ messages to be sent out again.
Generation, operation and destruction within the same Idea.
Generator Operator Destroyer
G. O. D.
GOD
The Man at the Front closed his hands together and continued.
“Every thought, idea, emotion and inkling you have or receive, if you like, directly affects the actual structure of your D.N.A. The more positive aspects nurture and help the different parts of your codeyyou to work more effectively and the negative do the opposite. It’s your decision how you filter these ideas and on what level the positive and negative is gauged. The catfish story, even with its twists and turns and its indictment of the Godhead, has arrived at your D.N.A. pairs as a constructive, positive moment. The words and letters from that story, as we speak, are, at this moment, revamping and regenerating your codeyyou. Basically, what you think, physically changes you. The doctors will discover this shortly. If one finds the part of one’s D.N.A. that’s negatively mutating and making one ill, then one can direct one’s more positive ideas towards it and make one better.”
The Man at the Front burst out laughing hysterically.
Theman shifted in his chair nervously.
Once the berserk barking of his mirth had subsided, the giggling Man at the Front continued again, this time in a mock archetypal Swiss accented mad scientist tone.
“Zee scientists know zat zee combinations of zee mutations of D.N.A are vot is responsible for evolution of a species. By zee process of natural selection and adaptation to changes in zee environment both zee genotype and hence zee phenotype of zee individual vill be altered.”
With a worrying wink, he returned to his normal voice.
“What they are totally unaware of however is what is actually prompting that moment of mutation in response to changes in the environment.”
The Man at the Front smiled at Theman and carried on again in his mock scientist voice.
“A good example is zee Kryptolebias marmoratus or, to zee uninitiated, zee mangrove killifish. Zis peculiar little fellow has started to live in trees in zee mangrove swamps of Florida. When zeir normal habitat of ephemeral mangrove pools evaporate during zee dry season, zay move up into zee bottom of zee nearest available tree trunk and make zeir home. To enable zhem to do zis, zay have had to obviously change zeir physiology. Zeir gills have mutated, as have zeir epidermal cells and zay vill eventually start to develop limbs. Zee evolutionary biologists have analysed zeir D.N.A. and have discovered marginal but also very important changes in zeir genome. All zay have to say about zis is that it is in response to zee changes in zeir environment. No mention of vhat is zee actual mechanism that is occurring within zeir D.N.A. sequences to cause zese changes in zeir physical appearance. Ideas, thoughts, perceptions!”
The Man at the Front roared these last three words out accompanied by a theatrical flourish of his arms in the air.
“Yes, zee killifish is also master of its own destiny! Its own thought processes, fantasies and dreams combine to alter its own D.N.A., enabling it to exist vherever it vonts. It’s zat zimple. Scientists are a little too logical and confined in zeir vorld view to spot zis at zee moment.”
The Man at The Front suddenly changed tack.
“The Chinese discovered centuries ago that the energy store of the body is in the kidney region. By meditative strategies they developed methods of circulating this energy around the body and purifying it in the process. Alchemy in action. The purified chi, as they called it, can then activate higher level energy centres and move the individual towards nirvana.”
He changed tack yet again.
“Guess where you are Theman?”
He left no space for an answer.
“You’re in the D.N.A of one of the cells in the walls of the renal pelvis in your right kidney.”
Theman started to piece together the scenario and asked the question that had been sitting with him from the start of The Man at The Front’s explanation.
“Where do The Ideas come from?”
The Man at the Front stood up from his chair and moved over to in front of where Theman was sitting.
“I can see what scenario you’ve started to create. You heard the words “kidney”, “higher level energy” and “nirvana” and linked this with the fact that you are here in the kidney D.N.A. I should imagine you think you’re on that route. You’ve experienced godliness, isolation moments, limbo and now it’s time to aim for the higher levels of enlightenment. Is that right? That’ll take you to the place where all questions are answered. Is that what you’re thinking? But Theman do you really think you’ve been through the mill enough? There is one huge flaw in your delusion. Before you can go up, you must go down. The alchemists knew this. To seek the truth, you need to sift through the base levels of existence, the secret hidden places; through suffering and confusion to find the jewel and then, and only then, can you take it up and show it to the Gods. You haven’t even started yet Theman! If you really want to find out where these Ideas come from then go and have a look!”
On the word “look” The Man at The Front took Theman by the shoulders and, once again, with the air of the demonic priest, bawled into his face
“Do you believe in the fire in your soul?”
With a sharp push he sent Theman flying back through the air off his chair and down into the opening of his renal pelvis; into his ureter and then the urinary bladder and finally down his urethra and out with a gush of urine to the waiting world below.
SECOND THREE
Drowning. Down, down and further down. Drowning. Down through the flailing limb spin. Down to drown. Drown Theman drown. Voidal disorient drown. Liquid suffocate muscle spasmic dive to the open armed space crush. Pressure difference drown Theman. He grabbed at water. He kicked at gas. He swallowed the suddenness that caught his throat and threw him side to side screaming hard against turning drown. Drown Theman drown. There is no way but down. And he fell and he fell and he fell and he fell until the falling ran through his blood, like shards of twisting and Theman saw to himself that he had a need to be dead. He saw how he might not struggle any longer. He saw the peace in it. The flood of deepening suffocate layered inside him and built towards its inevitable conclusion. He allowed the feeling to anchor and slowly tentacle itself around and then he let go. The pleasure was immense……
“No. It’s not your time yet.”
Theman turned to the sound of the voice. He saw the face of a Handcradling Woman, water drenched and large.
She held him in her palm.
“Are you rescuing me?” Theman blurted.
“Yes. I think you need it don’t you?”
She lifted Theman up closer to her face.
“You like death do you? Did The Idea feel good?”
Theman looked around himself. A most peculiar place.
He was now up to his neck in a thick whisked yogurty moving river of rapids and sprays that fell down away from under a typical little stone arched bridge. Typical of a fairy tale that is. It was the type of bridge that would have a troll under it and occasional travellers being told that they could only cross if they knew the answers to long impossible riddles. It was that sort of bridge. That is if you looked at it as if it was a picture in a book. If you were where Theman was at this time, it didn’t look like that at all. He was wedged in between two rusty poles that jutted out of the side of the arch pointing in towards the middle of what would have been the stream if it had been a stream, but it wasn’t. He was up to his neck in a goo that slid and buffeted and spat and belched its way out from under the bridge. It seemed to hang and twist and push and pull and flick its way around. It had a huge power to it that appeared not to lie in its speed or size but in its texture. It’s all-pervasive thickness of clog. Of course, from in front the scene was an idyll. A quaint pencil sketch of a bridge over a babbling stream waiting for an adventure to come into it and start. But underneath, in that space of the arch, the world was a completely different place.
“Well? Did you like the idea of death?”
He was back in the palm of the Handcradling Woman.
With this question in his mind Theman now found himself once again back across from the Handcradling Woman on the other side of the torrent, hanging from the rusty pole. His body buffeting ragdoll flail as the splurge continued to channel its way under the bridge. The aural landscape just did not fit with the visual; not the visual from where they were. What they were experiencing as the sound around them was the sound from the visual above the bridge. A babbling stream, birdsong, the occasional movement of leaves in a gentle wind. The churning mess of the mass that retched past them had no impact at all on what they could hear. It was disorientating to say the least.
She waved from across the other side. Her huge palm welcoming Theman back over to Mother. Simultaneously palmed and poled he tried to make sense of what was happening. The torrent of sheet cream continued to layer and layer through under the arch of the bridge. A relentless slide down past the two. Off into the deep gradient distance it continued to mismatch its sound with the scene. A battering, pushing roll on with a stationary summer balm moment. The delicately spaced harmonics of the birdsong and the distant forest speak riding easily on the back and within the curving, curling, spitting omnipresence of the splurge. It was a paradox that charged the whole atmosphere with a sense of impending change but at the same time also lent the scene a permanence that was so permanent that change seemed to have changed into something that couldn’t change but that gave the impression that it would.
“You can’t die yet Theman! There are The Ideas to find and her question to answer. “What’s the matter darling? You don’t seem yourself.” Remember? A job to do and nothing but that job to do. Four Seconds? You’re at the beginning of the third second and you’re very close to entering The It. Let’s go and have a look; you have some folk to meet.”
The Handcradling Woman palmed Theman and together they threw themselves into the splurge and off they went. Down and away. A job to do and nothing but that job to do. She led him deep and distant towards where Ideas and answers lay. The It. A place of no time, no structure, no Yes, no No. A haphazard haven of heroism, trickery, thoughtlessness and delight. The It stood, stands and will stand as a separate collective completeness of unfinished useless vital jewel. It was, is and will be a place of no place. Layer upon layer of onionskin wholeness. Each layer alive with its own freshness and pungent purpose of no purpose. A no purpose of purpose flying towards immortal death and razor-sharp rebirth. The Handcradling Woman lifted Theman up in her palm and blew him, as a kiss, off and away through the swirling breathing void that surrounded them. He turned and fell and climbed and bucked and twisted and dived like a bird at sea. He let his mind dance a disorientation jig as he careered down, down, down and alone and together and alone with the flow towards where he had to go.
The Skelton greeted him with a squeal of delight and a rat a tat barrage of words.
“Alright, alright, alright. Where have you come from, me matey? Come to see me, have you? I’m well known about these parts. I can take you wherever you want. Anything you need I’m your chap. A fixer, an entrepreneur, your archetypal middleman. If you want a plate of Mongolian fish paste crudités, fresh from the bazaars of Ulaan Baatar, don’t hesitate to ask. If you want a few minutes alone with whoever it was you missed out on in that fleeting moment you can’t quite put your finger on, then give me a shout. I am The Skelton.
I can bank a cert
I can invent a skirt
I can see the wind
I can protect your shins
I can blow your mind
I can help you find
A friend indeed
Or a plastic fiend
I’ll make you laugh
I’ll massage your calf
I’ll cut your hair
And make you scared”
The Skelton had the gait of a mountain walker, the air of an imp and the exuberance of an evangelical ankle snapping terrier.
“I can dance a hop
I’ll never stop
I’ll smell your past
And climb up your mast
I can set a jelly from a thousand feet
And make untidiness look very neat”
“I need the answer to a question.”
Theman just managed to prod his voice in between the cascading verse that was falling out of The Skelton’s mouth.
“An answer? Yes, my stock in trade,” he bawled out at the top of his voice, barely containing the delight at having a new task to excel at.
“What do you want to know?”
“My wife has asked me this question ‘What’s the matter darling? You don’t seem yourself.’”
The Skelton roared with laughter and ran in jumping circles around the confused Theman.
“Yes of course. That age old gem. And who may you be, young sir?”
Theman found himself becoming a little annoyed with The Skelton’s patronizing tone. His reply was somewhat curt.
“I am the man’s nerve impulse travelling towards an answer to that question. I have tried my D.N.A. and discovered that Ideas are mutating it and that these Ideas could be integral to the answer to the question. I have also found out that these Ideas are coming from an external source, The It, and that if I came to The It, I would find out what these ideas are and perhaps an answer to the question. I take it this is The It?”
The Skelton stared at Theman for a few seconds with what can only be described as an old-fashioned look.
“Why of course It is! The place of all questions, all answers and everything in between. The It is The It.”
Up until this point the two of them had been standing in a space of white floor and black surround. This started to melt into a grey and then a silver which opened out into one of those ornately framed fairy tale mirrors, floating freely mid air with a speaking face in it. The face this time was The Skelton’s, who grinned out at Theman from within the glass.
“I can wrestle trees
I can race with bees
I queue for months
Without getting the hump”
As The Skelton continued with his rhymes the mirror started to rotate, as a spinning top would, until it was travelling at such a speed that all Theman could distinguish was a blur of moving gold and silver. The verses continued, unabated.
“I can taste fire
I can hear wells
I smell hurricanes
And I make spells
I believe in fur
And skin and bones
And lie in the shadows
Wherever you go
I can be your guide
To light your route
I can help you understand
The unbelievable truth”
On the word ‘truth’ the rotation stopped, and the mirror floated once again in the centre of the space. The face of The Skelton had gone. The glass was now filled with a new face. A face of female that couldn’t quite be seen. She hinted at the receptive, at the creative, at the soft but it was only a hint. Theman couldn’t grasp a physical image of her. He could sense her only as a hidden, a turned away, an avoiding One. One of power and guidance; One of conduit; One of nurture. She spoke as if from within a dream.
“What do you think her question means?”
Her voice had a gentle insistence about it.
“‘What’s the matter darling? You don’t seem yourself.’ What does she mean?”
Theman’s answer was instantaneous. It had actually been ready for a long time, formulating itself in his hidden mind. Probing and seeking a balance to the disturbance that had been upsetting his life. It took the directness of the question to open it up for Theman to see and to articulate both to himself and the Mirrored Female.
“I feel as if a big car has stalled in front of my life, and I can’t get past it. And as I sit there behind this car blocking my way, I look out of the window of mine and watch others easily moving on through their existence, struggle free and happy.”
He hesitated for a moment as the rest of the answer started to seep into his consciousness.
“I watch the ease of their life, and I feel jealousy. It’s a jealousy that is nothing but destructive. It has become such that I’m actually enjoying the negative slide it places me on. Each time a situation arrives that involves a success that is not my own, the jealousy rears itself up and I ride away on its back, firing at all-comers, death to their advance. I sit like a fat rotting spider in a web and expect the rest of the world to join me in my misery and self-pity.”
“Yes, self-pity. It can feel enticing. Are you really at the hands of Invisible Gods? Are you victimised and made an example of?”
Theman stared into the mirror and let his thoughts settle.
“I feel impotent and alone in that impotence. I’m here searching for a way out, an answer that can take me freewheeling away from negativity into a new life. Where do I start? I have no idea. I’m lost and have no foothold on anything to give me a reference point.”
“Yes, you do,” interrupted The Mirrored Female. “Your wife’s question is the clue and the key in. She’s spotted it. Your Self. She said you don’t seem Your Self. Her love for you is the foothold you can start with. Stand on her love. Become steady and then start the search for Your Self.”
Theman let her words settle.
“But how can I start a search for my Self using somebody else. I need to find the way unaided otherwise it won’t be an independent process. It’ll be tainted and not true.”
The Mirrored Female’s face became a little more visual, a little more recognisable.
“That’s a one-dimensional view Theman. On this journey you have met and will meet many characters who can guide, trick, give you wisdom, confuse and help and they are all part of yourself. Or at least they make up part of the jigsaw that can come together as part of Your Self. Your wife is your mirror. Look into her well. You are hers; she is yours. Together you can move on. Find a place and time when the struggling can stop but please be warned. Her question has a hidden plea.”
Theman felt the essence of The Mirrored Female’s face start to show itself.
“At the moment your love is theoretical; based on preconditioned ideas; learnt but not experienced. She has sensed this. Do you really love your wife Theman? What is love to you? Part of your journey over these four seconds is to feel the truth. Throw away theoretical love and see if you can feel the real emotion. Don’t second rate it.”
Theman felt back tentatively over the scattered landscape of his life and lay the word ‘LOVE’ within its image. It had been a word of frustration. The core of which seemed to emanate from its transient nature. Its unwillingness to be defined. Its use as a weapon. He had been told so many times to love and also that he did love and that love was all conquering. The habitual use of the word had destroyed the centre of what it possibly could or would be. He had taken love as grey and lifeless. He had cheaply thrown it around as a philosophical concept. He had used it as a thinly painted sheen onto people and situations. But he hadn’t felt it. He had accepted it but he had never ever, ever really felt it.
The Mirrored Female continued. Her face a mirror indeed.
“Empathy Theman. A connection between all beings. An understanding of the way things are. Undenied. Accepted. Whole. Take the theoretical love, break it into pieces, wrap it up in bonds of time and throw it away to the far ends. In its place feel for the real Theman. Feel for the real. Feel for the real. Feel for the real. Feel for the real. Feel for the real. Feel for the real……………..”
The four words trumpeted out and blanketed themselves flat into a curled end flying carpet that swooped in an instant and lifted Theman up and towards the waiting Mirrored Female’s face.
They joined in a union of symmetry and melt.
Nose to nose,
then ear to ear,
then neck to neck,
then chin to chin,
then cheek to cheek,
then mouth to mouth,
then eye to eye,
then charybdis style
self-implosion
to the one hermaphroditic
Uroborus
self-digesting
disappearing
all becoming
twist and turning
rise and falling
someone’s calling
Agony.
He felt as if a stool the size and shape of a small easily assembled bed settee was forcing its way out of his anus. As it was trying to move through it seemed to fan itself open, jamming against the walls, attempting to push its way out of an opening that was just not large enough. The pain cramped up to the small of his back, settled there for a while and then pushed up into his diaphragm, squeezing a cry for help out of his lungs.
“Come on dear, you haven't had the first one yet! Dig in. It'll be over soon.”
Theman looked in the direction of where the voice had come from and saw an elderly, bespectacled lady dressed in hiking boots, cotton slacks tucked into woollen socks pulled up to the knees and a big, chunky roll neck jumper. She was bending over him staring between his legs.
“Yes. Once it’s started, it'll be over with before you know it.”
Theman looked up to see where the second voice had come from. There above him was the upside-down face of a man with a ruddy complexion and a small, white goatee beard. He had one of those insipid, patronising smiles on his face that made Theman want to scream.
He suddenly realised in his anger that the pain had subsided a little and he could begin to concentrate on what was going on. He was outside in the open, lying on his back on the grass, staring up at the faces of six people eagerly crouching down over him. The bed settee made its move again. The wave of pain rolled through his stomach and down to his sphincter muscles, twisting and turning, almost lifting his buttocks off the ground with its force.
“Help me!”
The Elderly Lady squeezed his hand.
“You're going fine my love. I can see the top of it. Just keep pushing.”
The others moved round to join her looking down between Theman's raised legs.
“Oh, doesn't it look lovely! Can you see it coming? Keep pushing, keep pushing. That's it. Well done love.”
“Big deep breaths now. Fantastic!”
“It's going to be lovely. Just what he needs.”
“I think the legs need to be a bit higher up. The angle's not quite right. Go and get a couple more rucksacks, could you?”
One of them disappeared for a few moments and then returned with two bulging backpacks which he went to lay down next to The Elderly Lady.
“Could you just put one each under the legs? That's it. Lovely!”
“That should do it. That looks much better.”
“They're getting closer together now. It won’t be long.”
The bed settee started to unfold again.
At the top of the hill Ignacious Pig Freak was waiting for his signal. He'd cleared the forecourt of any vehicles that had been upon it and had also put up closed signs to stop anymore coming in. This was a big day for him, and he didn't want it messed up by some irritant demanding his attention when he was desperately needed down there. He looked across the valley and counted them to make sure they were all still where they should be. Four ready to come in from the lake, four from the wood, six from the outcrop and two from the bridge over the river. Each of the groups were huddled together, exactly as he'd told them, waiting for his signal. He checked his six favourite Fell Walkers. Everything seemed to be going to plan but still no sign. He hoped desperately that it would all be OK. He was so proud of what was going to happen today. At last, he was about to have it there. All to himself. His very own. He couldn't believe, after all this time, that this day had actually finally arrived. He'd had to wait so long!
Something seemed to be going on down below.
“That's it. Only a few more inches to go. Keep pushing. Deep breath in and then push out as hard as you can.”
Theman felt as if he had started to tear in half. With each push and wave of pain, he had started to have to really concentrate on not passing out. The nerves in the muscles in the lower part of his back and the tops of his legs were on fire, his abdomen felt as if it had ceased to exist and the thirst! Since all this had started, he had developed an incredible need for water but his drouthy mumblings had only been met with smiles by his six carers.
“You know you can't have any don't you? Just think of what you're doing. You can have all you want in a few minutes. You'll only have to ask. Just be patient.”
“Here it comes!”
The Elderly Lady, who seemed to be doing most of the work, looked up at the others from between Theman's legs.
“I think I'm going to need some help with this one. It's huge!”
The other five quickly gathered around her again and formed themselves into a closely bunched queue leading out from the back of the crouching Elderly Lady.
She looked around over her shoulder at the one who was standing directly behind her. It was White Goatee.
“When I say, you grab the end of it and pull. Pass it backwards to the next person and so on and we should be ok. Be prepared, it's going to be a heavy one!”
Theman gave one last push. There was a low, sloppy, farting noise and then it was over. The relief was intense, so intense that it was almost painful. He rolled over onto his side into a ball and tried to rock himself back into some sort of normality. Some sort of I know Theman. Gradually the extremes in his mind and body pivoted in on themselves and his scene started to settle to the point where he could begin to become aware of what was going on around him. He rolled onto his back again.
He saw The Elderly Lady waving wildly up to the top of a hill. He saw the other five holding something long and grey. He saw a shape appear from over the brow of the hill.
He saw movements from all sides, movements like wasps homing in on something sweet. Circling, darting, invading.
He tried to sit up.
“Oh no you don't,” said The Elderly Lady. “You rest. You’re going to need it. Just relax and watch The Inkling. He's coming down to start it off now.”
Theman looked back up the hill to where The Elderly Lady was pointing.
Rolling down towards him was a garage forecourt, complete with petrol pumps and other garage forecourt things. On each of the four corners of the arrangement was a lavatory and on each lavatory was sitting a Coward, each of who was desperately trying to keep the toilets flushing. Theman could see why. With every flush a huge foot would come out from underneath the relevant toilet and give the whole affair a good push-off. If The Four Cowards managed to synchronise their flushes, then the force of four feet in one go was enough to get the forecourt up to a pretty good speed. The problem The Cowards faced was the cistern refilling. They couldn't re-flush it until it had reached a certain point and if they tried to, then they had to wait even longer to give it another go. The Cowards, being cowards, just couldn't wait. They started getting nervous if the cistern didn't fill up as quickly as they wanted it to and more often than not, they tried it before it was ready.
Attempting to oversee all of this was Ignacious Pig Freak, whose head, chest and flattened hose like arms could be seen rising out of the middle of the forecourt, shouting instructions to The Cowards. Theman noticed that he had a large sheet of lightning balanced precariously on the end of a freckled, turquoise snout that forced its way out of a head that could only be described as transient. One minute it would be a long, thin and upright corner location bungalow bathed in sunshine and the next it would be a netted claw pinching outwards at an eager fisherman's hands. The structure seemed to change every few moments, which threw The Cowards into even more disarray. Especially when his head appeared as one of those soft, velvety, purple bags you might put a jewellery box in if you'd just sold it in a situation where you were a sales assistant in a jeweller’s. The bag covered the whole of his snout and anything he said just couldn't be heard. To make matters worse the sheet of lightning was trapped inside it and a small fire started up in one of his nostrils. The Cowards had supposedly been trained to cope with these situations but once again, being cowards, they sat glued to their lavatories, petrified with fear, watching it all happen. Luckily Ignacious Pig Freak's head changed into a quiet moment by a reservoir and they were off again.
The Sixteen Cyclists, who had by now started to circle Ignacious Pig Freak, were busy blasting out “Happy Birthday” on their bells. They were acting as a form of convoy to the forecourt, as it trundled down the hillside towards Theman and his delivery team. Every so often one of them would scream out things like "a tad left" or "hard right" or "ease off a little" and Ignacious Pig Freak would acknowledge them and take the appropriate action, which more often than not resulted in them avoiding the occasional tree or ditch that they had been rolling towards.
Stopping was a sight to be seen. Everything was supported, except for the fleeting moments when the feet under the lavatories touched the ground, by one large ball bearing of a toe which grew out of Ignacious Pig Freak underneath the forecourt. It was a free moving spherical toe, also used for steering, which seemed to be sprung in some way inside the upper part of Ignacious Pig Freak's body. Whenever it hit a bump, it just seemed to absorb the change in the surface as if it had not been there. To stop the whole thing, he simply used his hands to caress the toe to a halt. His flattened arms, when the forecourt was in motion, were trailed down the side of his torso and flapped next to his revolving toe. At the vital moment his thick, rubbery hands opened out and started to stroke and fondle the toe. Probing here, tickling there, the fingers caused thousands of tiny erections to grow out of the digit, digging into the ground and eventually bringing the whole trundling forecourt to a standstill.
He pulled up within shouting distance of the small maternity group. The Sixteen Cyclists set themselves up in two concentric circles around Ignacious Pig Freak, one riding clockwise and the other anti clockwise, using their bells, at a low volume, to start to play a selection of easy listening classics. The Six Fell Walkers placed what Theman had produced on the grass in front of them and started to dance around it, rising up high with their arms stretching into the sky and then crouching low with their faces almost in their laps.
“Let The Inkling Begin,” roared Ignacious Pig Freak.
He lifted both his rubbery hands high up into the air above the forecourt, wiggled them around for a while and then let them fall like two diving kites down into the middle of the dancing circle of Fell Walkers. He plucked up the grey object as if he was picking a dandelion and hurled it like a rocket up into the sky. It climbed and climbed and climbed and for one moment looked as if it was never going to stop but then it seemed to hang still in the air for a few seconds before it flipped over and started to come back down.
“Ignacious Pig Freak, Ignacious Pig Freak
Everybody listens when he starts to speak
Strong and brave
He gives no change
When we buy petrol
On Saturdays.”
The chant had been started by one of The Cyclists and was soon flying round the valley accompanied by various hoots of laughter and clapping and of course the easy listening classics.
“Here it comes!” yelped The Four Cowards.
“Look at it go!” sang The Six Fell Walkers.
“Time for a drink,” chorused The Sixteen Cyclists.
“Quiet everyone!” bellowed Ignacious Pig Freak.
Just as he said this the grey object hit the ground with a thud directly back in the middle of the Fell Walkers, exactly where it had started out from. Their circle immediately broke and opened out behind the object. The Sixteen Cyclists joined them as did The Four Cowards, who stood two on either side.
For the first time Theman was able to see exactly what it was that had been causing all the fuss. There, embedded in the ground in front of the audience, about two arm's lengths high, made out of concrete, was a drinking fountain.
“Congratulations. Your first one. You did very well.”
Theman looked up to see who Ignacious Pig Freak was shouting at and realised that the comment had been directed at him. Before he was able to respond, a command came flying across from the forecourt.
“Fell Walkers, the plaque please.”
The Elderly Lady curtsied, ran over to one of the rucksacks that lay at Theman's feet, rummaged around inside for a few moments and eventually pulled out a slab of solidified gravy which she took over to the drinking fountain. One of The Sixteen Cyclists joined her there with a bag of tools and together they fixed the plaque firmly to the side, directly facing where you would stand if you were having a drink. It had these words scratched onto it.
“In honour of Ignacious Pig Freak whose good deeds and kindness will always be remembered by those who drink here.”
“Cowards please!” shouted Ignacious Pig Freak.
The Four Cowards came trembling forwards, a few steps from where they had been standing, not daring to look up.
“What are you waiting for? You know the rules. Hurry up! We've got a long way to go yet.”
They gingerly walked forward towards the drinking fountain, each of them struggling not to be the first to arrive, staring at the ground, visibly shaking at the thought of what they had to do when they got there.
“Never mind my loves. It'll all be over and done within a few minutes.”
The Elderly Lady patted each of them tenderly on their shoulders as they reached the fountain.
“Come on. Heads up. It's not going to be as bad as all that.”
The Coward who sat on the back right of the forecourt burst into tears.
“I never wanted to do this anyway. I had a job setting up drinking tanks for the paraffin makers. It wasn't my fault it all fell through, and I ended up on that bloody toilet. I shouldn't have to do this.”
“No,” blubbered Front Left Coward, “and I feel sick. Can't you get him to choose somebody else?”
The Elderly Lady became a little stern.
“Now, now! You know the rules. Come on. Wipe your faces on these and be brave. Five minutes and then you're finished.”
She handed Front Left Coward a few tissues to pass around and then gave them a gentle nudge forward. Ignacious Pig Freak was becoming impatient.
“If you don't start now, you know what'll happen. There are plenty more Cowards out there looking for a chance and I'm getting very, very, very tired of waiting. Remember what happened last time?”
They certainly did. They used to be Five Cowards until a while back at one of these Inklings. It had been for Pitc, one of Ignacious Pig Freak's prime teasers for not having his own fountain yet. All that had happened was that Middle Back Coward had sniggered at something one of Pitc's drainage experts had said. Ignacious Pig Freak overheard it and interpreted it as collaborating with the enemy. Without any warning his arms whipped out around Middle Back Coward's neck, lifted him up and away and smashed his body against a nearby rock face until he wasn't moving anymore. Then he ate him. Well, you couldn't really call it eating. More like digested him. He didn't pull him apart, chew him, undress him or anything like that. He was down in one. As simple as that. One second Middle Back Coward was there giggling and messing around and the next he was dead and gone, being dissolved inside Ignacious Pig Freak's stomach.
It was all it took. That reminder and they were off singing like larks. Standing around the fountain, arms gesturing out to their audience, smiles on their faces. You wouldn't have believed these Four Cowards were the same Cowards who had been sobbing their hearts out a few minutes earlier. They started off singing unaccompanied but gradually as the song built up steam, The Cyclists' bells joined in, and the Fell Walkers arranged themselves into a nice little skiffle group giving marvellous backing to the fine harmonising voices of The Four Cowards. The whole scenario presented a professional quality that had Ignacious Pig Freak beaming with delight.
Before long everybody there was singing. That is with the exception of Theman who was just lying on the grass, looking absolutely aghast at what was happening around him. The words of the song, when he started to make them out, worried him even more.
“He gave birth to seven daughters
At the hands of Six Fell Walkers
At the hands of Sixteen Cyclists
He gave birth to seven daughters.”
Those were the only lyrics he could make out. The rest sounded like complete nonsense, almost as if it was in another language. But those four lines were repeated quite regularly as a chorus, and it was a chorus that struck absolute terror into Theman.
“He gave birth to seven daughters.” That phrase would not leave his head. It stuck in there like a fork, thrust hard and deep into dry earth. He tried to tug it out, to release it so it would drift away but it stubbornly refused to budge. It sat there weighty, pronging his thoughts, causing him to return every second to the question. Why “seven daughters?”
He had somehow reconciled himself to the fact that a few minutes ago he had been standing talking to a mirror and that now he was lying on the ground surrounded by cyclists, fell walkers and a living petrol station forecourt, having given birth to a drinking fountain. But he could or would not allow the thought that was hiding in the shadows of his mind to emerge. The thought that actually had emerged but one he could not accept. They expected him to do it all again six times more! But why “seven daughters?” This question was enough to put a reasonable doubt in his mind that that wasn't what it was all about and any minute now Ignacious Pig Freak would announce there had been a terrible mistake and Theman should leave right away.
The song finished with a washboard solo from The Elderly Lady, whoops of delight and a long, heavy, sustained applause. Gradually it died away leaving the valley floor in almost complete silence, the only sound being one of the lavatory cisterns on the forecourt gushing with a stuck ballcock. One of The Cowards made a move towards it to try and fix it but was waved away by Ignacious Pig Freak, who seemed far too exhilarated about the whole affair to let something like that bother him.
“Don't worry about it. I'm not. You can have a look at it in a moment when our visitor has started on my second daughter. Let it continue.”
He addressed this last instruction to The Six Fell Walkers who immediately clustered around Theman in a similar fashion to the way they had when he had been going through the ordeal of his labour with the drinking fountain. Ignacious Pig Freak motioned to The Four Cowards to get back into position on the forecourt toilets, thanked The Sixteen Cyclists and asked them to be ready in position for the next one and then started to turn and trundle back up the hill to prepare himself for the continuation of The Inkling.
“Hang on a minute!”
Theman had, with the greatest difficulty and with not a little pain, pushed one of The Fell Walkers out of the way, managed to drag himself up on his feet and was shouting angrily after Ignacious Pig Freak. The chattering amongst everybody, as they had been moving away from the scene, stopped immediately to be replaced by a few scattered whisperings and a nervous cough or two. They all looked towards the forecourt to see what Ignacious Pig Freak's reaction was going to be. He didn't appear to have noticed but he most certainly did when Theman followed up with his second comment.
“What do you mean ‘my second daughter?’ If you think that the first thing that came out of me was your first daughter, then I'm afraid you are mistaken. It was nasty, tacky, concrete drinking fountain that looks like it should be outside the ground floor lift doorway of a multi storey car park, stinking of drunks' urine and covered in bird shit. And anyway, it was mine whatever it is and I will not, I repeat not, be having one more ‘daughter’, let alone six! So please give me my clothes back and show me how I can get out of here back to where I came from.”
The audience held their breath as Ignacious Pig Freak turned slowly and stared back down the slope at Theman, who by now had been pulled back into his birthing position by four or five dismounted Cyclists, armed with pumps and quite nastily sharpened bicycle clips.
“I have been waiting for this day for a very long time and it will not be spoilt by anyone, least of all you. You will be going nowhere until my, and I stress my, next six daughters are safely delivered. I do not understand why you have a problem with them being daughters. Did the fountain have a penis?”
Silence.
“Well, did it?”
Theman stared helplessly up at Ignacious Pig Freak from beneath the restraining hands of The Cyclists, as the rest of the audience burst out laughing and clapping.
“No, it didn't, did it? So, it is obviously a girl,” he continued.
“Now as for the fact of it being your daughter. Does it look like you?”
“Of course, it doesn't but........”
Theman found one of The Cyclist's hands clamped hard across his mouth preventing him from continuing.
“No, it doesn't, does it? So, it can't be your daughter. As it's not your daughter and nobody else is claiming it as theirs. Are they………..?”
He stared menacingly around the audience, watching them all shaking their heads and mumbling in agreement with what he had just said. He continued.
“I hereby announce I am the father of Daughter One and fully expect to be the father of Daughters Two, Three, Four, Five, Six and Seven.”
Another cheer and yelps of approval.
“Anyhow you wouldn't begrudge me the completion of the whole rest area by leaving now, would you? All I need now is the two in one bench and table, the information board complete with a heavy-duty glass front cover, the waste bin, the male and female toilet block, the snack caravan and the children's woodland play area. You should be able to produce those in a couple of days at the most and then, of course, you're free to go.”
Ignacious Pig Freak smiled down over Theman with a radiance that filled the audience with great joy and pride. They lightly clapped and beamed back at their leader with the faces of those totally besotted, totally dependent, totally in awe. Theman felt sick.
“Let the Second Inkling continue. Begin Daughter Two please. A bench and table will look lovely next to the fountain. I can't wait.”
Ignacious Pig Freak turned away, shouted instructions out to The Four Cowards and moved off again, this time uninterrupted.
Theman felt the weight of two Cyclists pinning his shoulders to the ground as The Elderly Lady once again took up her position between his legs. He tried to kick out, but they were ready for him. White Goatee and a Cyclist pulled one leg out to the side and one of the younger Fell Walkers pulled out the other.
“There you are my love,” whispered The Elderly Lady, looking up between his twisting splayed legs. “All ready are we?”
“No,” screamed Theman, as he felt the first movements inside of the two in one bench and table.
“Oh yes,” chanted the delivery team, “Daughter Two is on her way.”
“Please help me for God's sake!”
“What makes you think that’s going to help you here?” said a voice that had the sound of a voice that would welcome you in through a wooden door to a comfortable and cosy interior. So Theman entered. Troglodytic log fire warmth was his first impression. He sat down in an armchair in front of the voice. It continued.
“‘For God’s sake.’ That phrase just now. Why are you involved in a thought process that’s taking you outside looking to honour something or someone when everything is so obviously moving inwards?”
“It’s only a figure of speech, “blurted Theman. “I mean, I could have said ‘For Pete’s sake’ or ‘For goodness’ sake’ instead.”
“Why didn’t you then?” replied the voice of The Welcoming Man.
Theman had no answer.
“What is God?”
Theman had no answer.
“Where is God?”
Theman had no answer.
“Why is God?”
Theman had no answer.
“When is God?”
Theman had no answer.
“Is there God?”
Theman had no answer.
So, The Welcoming Man stood up and motioned for Theman to follow him. They settled themselves down at a table across the other side of the room and spoke to God. And as they all spoke, it became clear.
“Why did you rescue me?” asked Theman.
“Because you wanted to be rescued,” replied The Welcoming Man.
“And what will you tell me?” asked Theman.
“Whatever you want me to,” replied The Welcoming Man.
“Whatever you want me to,” replied The Welcoming Man.
“Why The Mirrored Female and the Ignacious Pig Freak birth scenario then scenario then?” asked Theman.
“Your lack of empathy with the feminine within yourself and hence your projection of this lack of empathy onto the women in your life,” replied The Welcoming Man.
He continued.
“The It tends to manifest itself to balance what is perhaps unbalanced in your conscious world. The conversation with The Mirrored Female about your wife and the agony you experienced in the birthing zone are probably hinting at your need to be a little more aware of this.”
Theman slid his thoughts momentarily back. An image appeared as if of an entry inside a psychology textbook.
The Submarine Smile.
An often-unconscious phenomena, primarily displayed by males, used as a control strategy normally directed at females. The smile is initially employed as a device of capture by charm, often manifested in the presence of others. However, when the perpetrator of the smile is left alone with the intended victim, the smile sinks as if beneath the surface of water. It is replaced with quiet animosity, neglect and detachment.
Theman recognised himself immediately.
They both stood up, walked back across to the other side of the room and settled themselves comfortably down in two different armchairs to continue.
“There are essential elements to all this. ‘What’s the matter darling? You don’t seem yourself.’ ‘A job to do and nothing but that job to do. Four Seconds.’ Theman Simpulse. Helpless but determined. Unguided but true. A tragic hero. Against all the odds you endure and endure and endure and endure. And you must Theman, mustn’t you? Because what else is there ever to be if not that?”
Theman felt the analytical answer tighten in his grip.
“I’m scared of what I will become, if in that dark hour I do leave the endurance and visit the outside. You’re giving me autocracy with your questioning. You’re painting hope as a saviour. You’re laying me inside the template of some kind of potential protagonist whose will can prevail. But I am not in control. I’m not aware. I’m not guided. I’m not solid. I’m Theman.”
The Welcoming Man let go of a smile and lifted something out from under his chair and placed it on the table.
“Maybe you’re a little more aware than you think. Take a close look. It’s a type of evolving holoracle which has been here pre-you, for-you, help-you, now-you, then-you. Funny shape, isn’t it?”
Understatement words indeed.
A moving hologram of Theman’s life presenting Theman figurines at different Theman life stages on varying Theman staircases in Theman’s past, present, future Theman personas. The figures were all in motion simultaneously recreating and creating the scenarios of his life gone and to be. The whole scene fell in and out of focus and drifted colour soundless interplay around the table area, leaving impressions and after plays; thoughts and confusions; joys and sadnesses; imprints and vestigial images that hung in the air like faint cigarette smoke, before fading and turning into the next in the image that was, is and will be Theman’s life.
“You can be aware you know,” said The Welcoming Man. “Please put your hand in there and see what you have to say.”
Theman looked to where The Welcoming Man was pointing and saw a figure of himself in the hologram, in his mid-twenties, walking up a staircase with his mother.
“Yes. Just in there and let him climb up and sit on your hand.”
Theman did as he was told. The figurine slowly turned and moved to sit calmly in the palm of his outstretched hand. He turned his tiny head and started to speak in analytical cathartic projections at Theman.
“I used to live with my mother. She had been twice divorced and I was the only child from the two marriages. We had a fairly stable relationship, with both of us giving the other space whenever it was needed. We were company and the reciprocal arrangement seemed to work. That was until that one day when I just woke up in the morning with the sudden thought in my mind that I needed to move out into a home of my own. The idea seemed to come out of nowhere and it was very strong. I immediately made a few enquiries, looked at a number of properties and within a couple of days had found the ideal place. I explained to my mother that it was nothing personal but that I just felt it was time for me to make a break. I was nearly twenty-five and I couldn’t live with her for the rest of my life. Her first reaction, from the look in her eyes, was one of deep sadness. That first instinctual real emotion that hasn’t had time to be wrapped up in social conditioning and thinking, but just appears as raw as it is. That first glimmer of truth that shines in the eyes like a piercing beam in the darkness. There for a split second and then turned off by the realisation of the need for its adaptation to circumstances that are outside its own existence. But still it was there as the truth. She was hugely saddened by the whole idea. However, within a few moments she was asking me questions galore. Would I need anything? When could she see it? Who was I getting to decorate it? Was I doing it myself or perhaps could she help? It was almost as if that moment of truth had been pushed back away into the darkness of the unspoken abyss within her. At the same time releasing a torrent of overamplified, guilt driven generosities to compensate for the terrible but true sadness she’d felt.
The exchanges of guilt at this time between the two of us were astonishing in their subtleties. Mine was the more leaden of the two on the surface. How could I leave a person of sixty-four years of age to live by themselves after what had happened to them? How could I think solely about myself to such an extent that it hurt, so successfully, the heart of somebody so close? And this is what I mean by the subtleties of guilt. This idea of purposeful letdown. The need for the feeling of self-preservation to ride so roughshod over my mother. It was something that I only latched onto much later in the whole process, but it was something that was a huge driving force at the time.
I wanted to hurt her.
I wanted her to argue back but she never did. I wanted her to be gone. Not even an idea anymore. I wanted the whole essence of her to be annihilated, erased from my memory so that her nagging presence would never irritate and torment me again. But even at that early-stage I knew that if she did cease to exist, the torment that would follow would be the stuff of nightmares. The sense of this was very strong. There was, I thought, an inherent guilt there. A guilt that would rise and lay upon me like a sodden blanket, suffocating me with its incessant damp of inert failure. Physically there, especially during the night, it seemed to rise from inside and the out, simultaneously, until it clogged my breath and made my skin itch and burn. It pervaded everything I seemed to touch or contemplate. That continual mirroring of every thought back into my own darkness, unseen, waiting for the next chance to slice up again and have another pick at smothering me.
And the subtleties continued. I could never have seen this at the time, but my mother was drying in the wind with it from every direction. As each day passed, she was rotting from the inside, brittle and bare. Her guilt had a multi-pronged attack forking into her each morning as she woke and each night as she lay sacking and flat.
She had ‘daughter you’ve taken my core away’ to face right from her beginning. Each meeting with her mother had the undying eternity of a slap of retribution. Her birth had cost her mother her life, if not physically, then at least on the emotional plane.
“There are rights and wrongs in these things and my suffering for you was wrong. Ever since I had you, I feel as if parts of my innards have disappeared. I feel incomplete and hollow and it’s all because of you. You took everything from me. My husband, my life, my dreams. You remain as a canker that blights my very time. Each moment you show any sign of movement I wish you back under the stone. If you grow, I wish you down amongst the worms. Flat on your back. Down amongst the worms. If you wish to adapt through your child I curse you damnation. You have taken me and made my existence stop. Inert and impotent, I lay next to you in time, your creator but an unwilling one. I wish you dead and not just that. I wish you dead in memory too.”
Of course, her mother never actually spoke these words to her, but the looks, intent and reactions were enough.
As were my mother’s to me. She had the guilt of her own child to contend with. Overcompensation. That’s the way I would describe her reaction to her mother’s relationship’s effect on her relationship with me. Overcompensation. Her driving force in that box of her life was to lay prostrate in front of her child and give herself away. Her mother hadn’t done that, but she would go to the ends of the earth to give her offspring everything. No child of hers was going to be unloved or unwanted. Nobody was going to be ‘another her.’ Her child was not going to suffer as she had. But in the maelstrom of the ripples in the pond, with the continual motion of what is, she had no choice. So I took my place in the process and became an inverted version of what she had been to her mother. And despite her continual flotsamic efforts to avoid this; what she actually did was create it. Each day with her incessant need to reaffirm her position as the antithesis of her mother, she actually managed to become more like her than she could ever, ever have feared.
However, even as I sit here describing it to you, the whole story slightly shifts. The essence of guilt ebbs and flows. I tied her core guilt down, I believed, after I had identified her relationship with her mother, to something far removed and far deeper and archaic. The previous was all, as I said before, flotsam. Something that is only of surface value, a facade of easy availability. The reality lies and drives underneath and once I’d seen what I thought that reality is or was, I realised what was really the force behind her eventual demise. Her avoidance of truth. Her hiding of her own realities from herself. She had been given the opportunity, at that point when I had told her about my moving out, to be with her sadness, to feel it for what it was. A moment of truth amongst all the moments of lies she had seen throughout her life. But she couldn’t. The sadness was cast away. An unwelcome visitor back into the grand abyss. Back into the shadows to lurk and grow and mutate until it springs out again but this time not as a welcome gift of sadness but as a writhing mass of contradictions and fears that are just there to destroy. Why she couldn’t take that sadness and love it and hold and kiss it, explains a great deal about how everything seems to fit into this whole movement but that’s another story. However, I did believe that I had managed to understand where the spring of her guilt had trickled from.
And then I started to witness the horror of her decay. The decay that was seeded upon this guilt of the denial of one of nature’s truths. Our suffering and our need to initially be with it. This is how I saw it at the time, and this is how I progressed on with it. Everything that moved with her, moved on in this framework and it did move on quickly. My flat, her best wishes, her loneliness, the alcohol, the retreat, her need to fail, her impending spiral down to the point of there not being a spiral anymore and then The Day. The Day Of The Decay’s Delight. She could shake her own hand. She could kiss her own feet. She could say that she had got to where she wanted to be. She collapsed in the street. A stroke?
Well, you deserved it didn’t you?”
Theman’s figurine had turned and started to address himself to the image of his mother, who now stood alone inside the holoracle.
“What with all that smoking and drinking and you didn’t really exercise either did you? So, they took you to the hospital and kept you in for observation.
‘She seems ok now,’ the doctor says.
‘She can be discharged.’
But you don’t seem ok, do you? You’ve gone away.
‘Oh, it could be sodium deficiency. We’ll keep her in a little longer to check.’
And then you do start to really leave me and the changeover is starting to complete. I see you propped up in the corner chair by the bed, semi-comatose. Mumbling and dribbling, slow-motion hand to mouth. You look and you don’t recognise, your eyes are glassed to me, and I start to feel a new internal push.
Indignation. You have deserved this all your life. How dare you drag me through this! I am revolted by your weakness. You and just you have destroyed my life. Two divorces and the under the surface hooks in. You came to me, and you shouldn’t have. You should have taken this on yourself. Instead, you loaded me with everything, your suffering, your pain, your decay. It was you and not me and the astonishing fact is that you could never see it. You genuinely did believe your own lie. Or at least you had got to the point where you had pushed it so far under the surface that it ceased to exist to you as a thought. But it was continually rotting away there, deep in those bottomless spiralling caverns. Every so often sending up a painful reminder of its presence. Every so often running your life without you being aware of it. And the disgusting truth was that it was also running mine. You had allowed this to happen to me as well. You, my mother, had stood unaware at the gates of your own salvation and you had turned away. You had refused to look down into that chasm. You had refused to see the truth and for that I wished you dead.
And then my realisation. My realisation of how I had been tricked. Not by you, not by your mother but by myself. That whole sequence of indignation rising up to extreme hatred, culminating in matricide, had all been illusion. Illusion designed to feed that eternal destroyer of mankind’s advancement. The self-manacled chains that tighten with each affirmation of its presence. The shadow matching every step we make, waiting to trip us up at every opportunity. Guilt.Guilt.Guilt.Guilt. I can feel the footsteps now. It was performed so skilfully that you wouldn’t have known it was there. But it had been and now it had me firmly in its grasp. Its hook snake fang stream of poison held me in its cancerous control. I was helpless, being engorged by decay from what seemed to then be my very centre. At the point of my wishing your annihilation, guilt casually stepped around from behind me, shook me by the hand and then proceeded to ruin my life. I thought I had understood it. I thought I had it boxed, harmless and confined. But I was so, so wrong. From that moment onwards my life fell to pieces.
‘Your mother has permanent brain damage.’
‘It’s low-grade Alzheimer’s combined with multiple infarctions throughout the brain.’
‘She’ll need to be assessed by our mental health team.’
‘She’ll never return home.’
‘She’s incontinent, doesn’t know where she is and is almost completely immobile.’
‘She needs twenty-four-hour care in a home for the elderly mentally infirm.’
‘I’m sorry to tell you this but she’s probably got two years at the most.’
These comments and many more pasted together over the next five or six months to create a terrible collage of truth that hung draped over me every second of the day. You were mentally ill, insane, mad, incapable and the terrible awareness was striking home. It was a permanent state. Not something that would improve or stabilize but a condition that was on a downward spiral. And so you fell. Down through numerous mental health assessments, down through the local psychiatric wards, down through close observation over Christmas in a secure unit. Down, down, down and with each descent you dragged me with you. A willing free faller into my own personal hell.
Each time there was a change in your situation, a new location, a new deterioration, my mind would slip back to the day I left. The day I moved out. The day I betrayed you. And every time in my day-to-day life, if I tried to return to some kind of normality once again, the image of your face at the door, as I drove away at that fateful moment, hung in front of me like a death mask. Guilt put you everywhere. If I looked in a mirror, there you were. Your eyes in my eyes. My nape of the neck, your nape of the neck. When I ate, you were there on my plate. Within the taste of garlic, I could hear your voice. Within the fragrance of herbs, I could see your hands gesturing. If I tried to sleep, you would be standing in the folds of the curtains or facially expansive in the shadows of the room. Everywhere I turned, or stood, or sat or lay, you were there. A reminder of my non- action. My selfishness. My neglect.
It was your placement in the rest home that brought on my eventual collapse. It was peculiar really because I had seen you in a fair number of these types of places over the previous few months. The faint smell of urine and disinfectant, armchairs, disturbed gait, mantis stance, security code punch ins on the door, unwatched television. But the problem with this one was that it was the final one in my mind. It was where you would be. Where you lived. And it was the finality that ultimately turned the screw.
I started to find it increasingly difficult to operate in the normal sphere of things. Anything that previously would have been a minor inconvenience because I didn’t want to do it, became a huge problem. A problem that lay dormant destructive in its ability to allow me to give every situation a power of domination.
I needed and wanted to feel the conflict. I needed and wanted to empower the disempowered. I needed and wanted to fail, decline, collapse, fall. But it wasn’t a fall to freedom, a drop into the unknown. An adventure. It was a need to fall to my own end. A termination. A disappearance. I wanted to just go. Not in a blaze, with a flourish but just to be blinked out. Here then gone. Nothing else but that. Nothing else but nothing. I needed your disintegration to be mine. Detritus to be shared. Rubbed out of the way. The two of us together. But together was not part of what was there It was just me and
I. had. caused. your. Madness.
Guilt followed me and pulled me in whatever I did or thought. And it followed and pulled me down and away. Hairshirt, self-flagellation, Christ, suffer, original sin, suicide, no me, lacking, pleasure in pain, no pleasure in pain, ancient cutting, wiggle the painful tooth, dig in the wound, fire on flesh, poor little soul, well just one more then, right and proper, duty, morals, eat jam after your tea, how would you feel, it’s not fair, masturbate in front of your granddad and he’s dead, push your parents apart.
And the physicality of hyperventilation, lack of balance and coordination. Insomnia. Night sweats. Day sweats. Neuralgia. Migraines. Muscle weakness. Pains in the joints. Hives. Stomach cramps. Nausea. Retinal sensitivity. Ringing in the ears. Neuritis.
The collapse of connections and sequence spawned useless. Alienation and loathing. The previous real unreal and unrolling, unravelling a new reality of nothing but nothing and away and a falling. I was captured alone in limbo, pinned and torn on a rotation crushing me from the inside out. More like sucking me. Taking everything but and then leaving the ‘but’ there by itself to grow into ‘butbutbutbutbutbut’ and then why not start again. No harm done.”
Theman interrupted himself.
“ Why ‘no harm done?’ It sounds from what you’re telling me there was a fair bit of suffering going on in my life. I wouldn’t have said ‘no harm done’.”
The figurine continued.
“Don’t forget I’m speaking with the benefit of hindsight rippling through my mind as I’m telling you this. I now know guilt’s power and impact but then it was away and hidden. Hidden and active. As I’ve said previously, it was running my existence without me knowing it and cleverly, in its destructive way, directing me towards a nadir that had an aspect of the eternal about it. At the time it was happening, my mind and the concerns of my self-preserving being were one dimensional to the extreme. I saw it as a purely physiological problem. I knew I was upset about my mother’s demise. I felt sad and tired and sometimes lonely but I would not let it enter into my mind that what was happening to me could be caused by anything other than something physical. That was the route I took. Obsessively so.
1. General practitioner one. Dead end
2. Blood test one. Dead end
3. General practitioner two. Dead end
4. Blood test two. Dead end
5. General practitioner three. Dead end
6. Blood test three. Dead end
7. Referral to local hospital for cardiological and neurological examination. Dead end
8. Visit to private clinic to see neurology consultant. Dead end.
9. Referral for neurological second opinion. Dead end.
10. Self testing for hypoglycemia. Dead end
11. Visit to private allergy specialist. Dead end.
12. Homeopath. Dead end.
13. Herbalist. Dead end.
14. Reflexology. Dead end.
15. Acupuncture. Dead end.
16. Then the doorway appeared. ‘What’s the matter darling? You don’t seem yourself.’”
The tiny figure stared hard into Theman’s eyes.
“And that’s where you are now and why you’re here. The search for the answer to that question and your rebirth.”
“Do you remember this one?” interrupted The Welcoming Man, pointing at another figure walking up a staircase at the back of the holoracle. Theman gently lifted the figurine onto his palm and listened.
“The Sex Chamber is purely for the benefit of all involved. Sex goes out the window, down the drain and the pan, scatters into the atmosphere, cuts into the cosmos, returns to the kidneys, blows a raspberry and pops, disappears, fades and sinks, goes under the finger nails and is picked away, is exorcised, flagellated, ridiculed, a joust between the genitals, an archaic automaton, the flapping pages mush in the rain, quick side step of masturbation and a throw into the firmament, sexual revolution, cannons at dawn, picked up like tin soldiers and flung across the room under the sofa, dust gathering rubric, whipped up in the scoop of an eyeball and away.”
“What about this one? This was quite interesting.”
The Welcoming Man pointed to a figure sitting next to what looked like some kind of matted fur. As soon as the figurine started speaking Theman remembered the moment. He’d been out on one of those idyllic Sunday afternoon drives. Sunlight dappled through trees on a country lane, idle conversation with his wife, relaxed silences, plans for a future life, love, cows in the fields, love, Badger Roadkill. They’d both seen it. A cursory glance but not a word. Badger Roadkill. Squashed animal red, black, white colour array but not a word. A part of the modern country scene perhaps. Badger Roadkill and all that entails. And all Theman could keep in his mind for the next few troubled days was “What colour was the Badger Roadkill?” It became an obsessive chant in his head. A mantra designed to disturb. An image of death that wouldn't disappear.
Over the next few hours, using the moving holoracle and the assorted figurines, Theman and The Welcoming Man revisited some more of the prime moments of Theman’s life and started to unravel the core themes that lay in the background driving it. He began to feel that at last he was making sense of who he was, why he had become who he was and how he could move himself to be the person he wanted to be. The Welcoming Man sat as an empty vessel of transference throughout. Occasional guiding questions but generally simply listening to the figurines and Theman; replying with carefully chosen nods, smiles and hand gestures.
Eventually The Welcoming Man sat back in his chair and brought the process to a close.
“At last, my friend, I think we’re getting there. Don’t you?”
Theman thought about the question for a few moments. He let his mind wander back over his journey so far. He did feel as if he was starting to piece something together. A jigsaw of possibilities. A hint at who he actually was. But still The Ideas conundrum. He had learnt how Ideas could mutate D.N.A. He had seen them physically harm and repair his own. He had seen them come and go but he still had not discovered where they had originated from.
The Welcoming Man seemed to sense Theman’s question before he asked it.
“You’ve been told. The It. They come from The It. Here. You’re in It.”
“Yes, but why does The It exist? What’s Its purpose?”
The question made The Welcoming Man laugh out loud.
“It has no purpose. Nothing has. Its meaning is that it has no meaning.”
Theman looked confused.
The Welcoming Man continued.
“Look. Why does everything have to have an answer? Why can’t some questions just not exist? Just being. No questions. No answers. Just It. Nothing and everything. Simultaneous truth. All.”
The Welcoming Man hesitated for a moment and then circled two of his fingers quickly in front of Theman’s eyes.
“Look. See what you make of this. It might help.”
Theman looked around. No Hologram. No staircases. No figurines. No log fire warmth. No Welcoming Man.
He turned around three hundred and sixty degrees. He was inside what looked like a hotel room. There was a single bed up against the wall next to a small wooden bedside cabinet with a lamp on it. Next to the lamp was a leather-bound book that Theman took to be a Gideon's bible. He went over to have a look. It was. On the adjacent side of the room to the bed was a chest of drawers positioned under a plain square wooden bordered mirror, from the top right-hand corner of which was hanging a battered, old, red, open faced motorcycle helmet. He walked over and tried it on. A perfect fit of course. He knew it would be. He looked at himself in the mirror.
The features of his face hung drip grey long inside the frame of the helmet.
“What do we do now then?”
He looked at his reflection waiting for a response. Nothing.
He focused on the eyes.
“Where do you take me then
my two dark entrepreneurial pits.
Deep inside or out again? Or perhaps nowhere.
Why do you look at me so blankly
Shrouded by your hermit's lair?
Solitude in silence
No multitude in there
You hint to me of pathways
But nothing opens up
Two intangible ideas”
Theman looked into the mirror.
“Where eyes? Where?”
The answer was almost immediate this time.
They took him over his shoulder and to the window which sat in the wall opposite the mirror and chest of drawers. They looked out. Theman felt a sharp intake of breath balloon into him as the scene outside shifted from an image to a thought.
It was a landscape mid destruction. Buildings were crumbling. Concrete towers sliding away from underneath themselves, folding up and flattening. Huge rectangular blocks teetered and then fell, complete until they hit the ground and then wrenched apart as if by two gigantic hands tearing a flute of bread in half. As they collapsed, immense clouds of dust were thrown into the air, bellowing upwards, hanging and then slowly dispersing to allow the scene through again. Settling for a moment and then off once more as the next structure began to fall. It reminded Theman a little of someone picking up one of those shaking snow scenes in a jar. Jerking it into a commotion, letting it come to a rest and then starting again.
“What!”
The air squeezed back out of him; rapid asthmatic tight.
He pressed his face hard against the window to try and get a better look at what he thought he'd just seen. Almost directly below where he was standing, coming through what looked like an ex-road, was an upward thrusting, time delay speed wise, gnarled, centuries old tree trunk. He stood and watched it as it grew, climbing up the outside of the building he was in, until it stopped directly in front of him.
It just stood and stared. At least that's what it felt like it was doing to Theman. At the very top of the trunk, set deep into the scaly armoured bark, was what looked like a wooden eye. It was not a wooden eye in that it was just part of a tree that takes on a shape that you playfully imagine is an eye. It actually did look like a wooden eye, and it appeared to Theman to be staring straight at him. He moved his face back up to the glass to take a closer look.
Suddenly, as if prompted by this movement, the eye opened up and a branch grew out of it, smashing through the window, missing Theman’s face by the smallest of margins. He ran back to the other side of the room and sat down on the bed, cursing at his newfound arboreal friend.
He took off his crash helmet and launched it through the air at the offending branch. His aim was good, and it looked as if it was going to hit it right in the middle. However, just as the helmet reached the outstretched bough, the trunk seemed to shudder a little, the branch moved up and the crash helmet flew past it, thudding into the wall on the other side of the room.
Theman had just started to look for something else to hurl at the invader when he noticed that there was something attached to the end of the branch. It seemed to be waving whatever it was towards him. He moved around to the other side of the room so he could see it more closely. It was a piece of paper with some writing on it. He moved in a little nearer:
“READ THE BIBLE.”
As soon as he’d read the message, the branch fired back into the tree trunk as if it had been on a spring. The eye closed up, the trunk started to descend, and he was just quick enough to get to the window to see it disappear back into the ex-road.
Outside the scene was much as it had been before. Buildings disappearing from sight every moment. New ones taking their place. An evolving landscape supreme. However, something had changed since he had last looked out across the city. Vegetation. It had become apparent. Simply that. Amongst the debris were appearing small areas of greenery which he could only surmise were some form of plant life. He looked down at the ex-road again to see if there was anything down there that would give him a clue about what was happening. Sure enough, there was. Growing up through the hole that had produced the tree trunk was the beginning of a piece of savannah grassland that was increasing in size every moment. Not only this, but it was also coming complete with an assortment of animals. He spotted a small zebra, numerous birds and, he thought, in the distance, a lion.
He glanced back out across the city. More bush than concrete. Even the piles of rubble that had been there before, just a few minutes ago, had started to already be covered with ivies and bindweeds. In the time he looked, he saw small conifers appearing in gaps between the broken buildings, shrubs and bedding plants populating what had been the pavements and large equatorial trees already starting to canopy the skyline of the ruptured city.
He turned back into the room, remembering the message on the branch.
“READ THE BIBLE.”
“It has to be the one on the bedside cabinet,” thought Theman, as he walked across the room.
Sitting down on the edge of the bed, he opened it up this time and quickly thumbed through it. Every page said exactly the same thing. Just three words.
“OPEN THE DOOR.”
He looked over at it.
“Pretty hotel doorish! That's all. Nothing else,” he thought to himself. But then Theman was more than aware of what was the concept of The Door. Not the door itself but what was behind it and where it led.
“That could be anywhere in this place,” he mumbled to himself.
He went over and stood in front of it, having a closer look. Nothing special from this side but what secrets did it hold on the other side? He turned the handle and yanked it open.
“Not now. Shut it!”
The command had been short and sharp and rich with authority. Theman slammed it closed. He'd not really had time to see anything other than a few shadows and something that looked metallic before he'd closed it. However, what happened next made him glad that he had done as quickly as he did.
The sound only lasted for about eight seconds and for about four of those it was rising and falling. When it hit its peak for the other few seconds, it was awesome. It sounded like bottled thunder at its loudest point. Similar in a way to essential oils where the pure essence of a flavour is captured and then concentrated. This sound was the sound of thunder squeezed into a small container and then refined to such a degree that the actual noise level was unbearable. It appeared to Theman so extreme that he had to block his ears and even this still didn't prevent the resonance paining through his head.
As it passed and faded off into the distance, he tried to place it in context, dragging items into his mind that could have caused such a commotion in a hotel corridor. The logical answer was nothing but, as he was aware, The It is not a logical place.
The door flew open.
“Sorry about that but you wouldn’t have liked to have been on the other side of the door when they came past!”
He looked like a fairground worker. Heavy, bushy sideburns, thick black hair greased up into a quiff and dressed in a checked shirt and grubby denims.
“What was it?” asked Theman.
“Why don’t you come and have a look? They've gone now but we can go inside, and we should get a glimpse of them. We've got a bit of time before you need to start anyway.”
Before Theman had had the chance to ask what he was supposed to be starting, the man had opened the door and climbed through. "Climbed" because what was on the other side of the door was not what you would have expected. Not a corridor, not a staircase, not even another room but a four-metre-wide metal chute, rather like a huge children's slide. It was confined by two bare brick walls on either side of it and it was raised so that it was about halfway up the door frame. The man had managed to clamber onto it by himself and was holding out his hand to pull Theman up.
“Quickly! They’re coming more regularly now. They know you’re here. We’ve probably only got a few minutes before the next lot come.”
He hauled Theman up onto the chute and pointed the way.
“Up there to the left of those two is a small glass door. It's just big enough to wriggle through. We’re going to make for that.”
Theman looked ahead. The chute sloped up to a brow about sixteen metres away. Standing at the top were two other men dressed in a similar way to the man who was crouched down by his side. They were both in what looked like a ship’s crow’s nest. It was a circular, wooden platform raised up next to the chute, about four metres high, with stakes and wire meshing creating what looked like a temporary fence around the edge. They both showed no interest at all in what was happening down near the hotel door but were more interested in what was occurring over the brow of the chute.
“They’re lookouts. They let us know if anything is coming. It’ll give you a few moments to get out of the way.”
He started up the chute.
“Come on. Up to the glass door.”
They slowly pulled themselves up the left-hand side of the chute using the raised ridge to get a grip. The slope was only about forty-five degrees so it wasn't too difficult to climb and after a couple of minutes Theman found himself looking at the glass door that somehow he had to squeeze through.
“It’s tiny. How the hell are you supposed to get through that?”
The man closest to this side of the platform looked down laughing.
“Don’t you worry about doing that! You wait and see. You’d be better off worrying about what it is you’ve got to get through that gap over there.”
He pointed down to the wall on the other side of the chute. Directly opposite where Theman was crouched was another opening. This one was about twice as big as the glass door but was filled with two hinged wooden boards held shut by a black, wrought iron latch.
“What does he mean ‘wait and see’?” thought Theman. He didn’t have a chance to enquire. Something was on its way.
“Quick Tal. Two more coming from the east. Get him inside!”
Tal opened the glass door and beckoned to Theman to go through.
“I’ll never get through that. It’s impossible!”
“Yes, you will,” said Tal. “Just think small and thin. Think snake and you’ll just slither through.”
And sure enough, he did. The opening only appeared to be just about big enough for his head but once that was through, the rest of his body seemed to fit through easily.
Tal followed through feet first. He still seemed to be having a conversation with the two lookouts.
“They reckon there’s going to be two passing in about thirty seconds. Fancy a look?”
He pulled the glass door shut and moved aside so that Theman could see through it. All he could make out at the moment were the wooden doors opposite, the chute and the metal supports of the observation platform. Then they were there, then they were gone. The legs and bellies of two fully grown lionesses flew past, visible for a split second and then away. There had hardly been any sound at all, just a small scratching, probably made by the edges of their claws sliding against the chute.
“But the other noise? It couldn’t have been...”
Tal laughed.
“No, what you heard inside your hotel room were two charging rhinos. Not something you’d want to get in the way of, I’m sure.”
Theman shook his head a little bemused by what was going on.
“Where are they going?”
“Back out here,” said Tal. “They’ve come down the chute looking for you.”
“Looking for me?”
“Yes. Looking for you. They’re trying to kill you. You must know that.”
Theman tried to work out what to say next. The animals, that were coming down the chute, were trying to kill him!
“Why are they trying to kill me? Has this got something to do with The Welcoming Man?”
Tal looked blank.
“I’m sorry but I’ve never heard of The Welcoming Man. He’s not from around here. If he was, I would have heard of him. I know everybody in this place.”
He paused and looked at Theman.
"You shouldn’t be here, should you? That's why you’ve got to do this because you shouldn’t be here."
Theman was starting to get annoyed.
“Do what?”
Tal pointed up to the top of a dry earth slope which lay in front of them away from the glass door.
“Have a look for yourself and then I’ll explain.”
Theman glanced up and realised, for the first time, that they were outside. He could just see a strip of blue sky stretching between the overhanging roof from where they'd just come and the top of the earth mound in front of him.
“Where do they lead?” he asked, pointing towards two pathways running perpendicular to one another, down either side of the slope.
“Go and have a look but be careful. Don’t show yourself too much. There could be some of them close.”
Theman easily scrambled up.
Tal followed up quickly behind him.
“Look over there. Use those two bushes as cover. You can just get your head underneath. That’s it. They shouldn't be able to see you from there.”
The scene unfolded in front of Theman like a children’s sticker book gone wrong. This place had that feeling of change and movement about it although it was happening in quite a different way. It was as if a backwash of veldish, bushish, shifting plains, heat rising shimmer air was being imprinted upon with stabs of incongruous alternative ecosystems. Each of these ecosystems initially lying disparate on the surface but then gradually melted into the overall jist of that particular area.
“Have a look at that one”
Tal tapped him on the shoulder and pointed over into the distance.
A huge slice of ice and piercing sky, pedestalled upon a grey lapping sea, thumped over onto some parched scrub, sending a pack of hyenas squealing away as it settled into position. The sea started to amalgamate with the dusty groundscape; firstly, into a cakey roux and then, as the liquid started to base, into a murky, globby lake which stretched out in front of the ice.
“That hasn’t changed for a few days. When it happened it just took seconds.”
Tal was pointing towards what looked like a torn piece of outer space stuck onto the corner of what appeared to be one of those neglected littered areas of gorsed central reservation that lay fumed and battered between major carriageways around the world. It was difficult to amalgamate the two together in the mind because the dimensions were so extreme in their differences. The torn piece of space had that sense of infinity about it even if you didn't know what it was. In terms of the dimensions of the landscape, it was probably only as big as an average primary school’s playground, but its depth was unfathomable. That, lying on the edge of the central reservation, was a difficult concept to accept.
“Can we go and have a closer look?”
Tal looked at his watch.
“Ok, we’ve got a few minutes to spare but then you’ve really got to start.”
“Start what? You said that before. What have I got to start?”
Tal was already halfway back down the slope.
“I’ll tell you when we’ve finished out here. It’ll be easier to explain inside.”
Theman caught up with him and they both started to walk down one of the perpendicular pathways. On one side of it was a brick wall going up as far as you could see, which Theman surmised must be the other side of where the chute was and in the other direction was the slope rising above them like a huge ant hill.
“Come on then but please be careful.”
As they continued to walk down the path Theman suddenly noticed something very peculiar. There was no sound at all. Of wind. Of animals. Of being outdoors. He questioned Tal about it.
“Yes, we used to think it strange when it first started happening but you get used to it after a while. The only time the animals do make any sound is when they come inside the chute and funnily enough when they get near to us out here.”
“Where are they now? I saw a few birds and I think a dog and those hyenas but where are all the others?”
“They’re out there somewhere. There’ll be a few from that ice cap already wandering around.”
He looked back at Theman.
“But don’t tempt fate. Don’t desire to see them. I’ve already told you that they are after you. Any chance they get, they’ll have you. That’s why you’re here; that’s why they’re here. It’s an arrangement.”
“An arrangement by who?” asked Theman.
“I’ve no idea. It’s just happened like that. For the time being we must just concentrate on what we’re doing out here. Now....”
He stopped speaking suddenly, slowed down and pulled Theman close in against the slope. He put a finger up against his pursed lips. Theman froze and strained his ears to see if he could make out what had stopped Tal in his tracks. He couldn't hear anything. Nothing at all. But then he did. Very faintly at first but definitely increasing in volume. The sound of something moving through the bushes that lined the top of the slope. Theman turned his head and stretched his neck upwards to see if he could see what was making it. He felt Tal tighten the grip on his arm.
He spoke in a gritted whisper.
“Don’t move!” he hissed through his clenched teeth.
Theman nodded and set himself silently in against the side of the slope as flat as he could get himself. Thinking snake earlier seemed to have worked so this time he thought envelope.
The movement above them was getting closer and closer. As it became more discernible, it sounded to Theman as if whatever it was that was moving along the top of the slope was tearing up each of the bushes as it went past them and throwing them down the other side. He glanced sideways at Tal hoping to get some indication from him about what he should do. There was no reaction. Theman started to feel the streams of panic linking between his throat and stomach. Only very small at the moment but they were definitely starting to flow. He closed his eyes and tried to calm them away, but it was no good. They were there and they were there to stay. His only chance was to try and control them.
The sounds stopped just above where they were standing. Theman pushed his throat and stomach apart with everything he could muster but if his fingers had been clinging onto the top of a cliff, they would most definitely have been losing their grip. The silence was almost unbearable. He felt himself starting to go. The streams had risen, turning into raging torrents ready to burst their banks. He knew he only had a few seconds left. Then.................
Whatever had been up there took off. The movement this time was less rhythmical. There was no pattern. Just what sounded like a huge concrete ball crashing through trees. No deliberation, no thought. Just raw movement fading off into the distance.
“Let’s have a look.”
Tal climbed up to the top of the slope pulling Theman up after him.
“Someone’s going for The Quick Way. Look over there!”
Theman was too busy watching the rapidly disappearing gorilla that was hurtling down the other side of the slope, tearing up anything that got in his way.
“Yes. He’s seen him too. That’s how we escaped. He must have noticed him running as he was just up above us.”
Theman looked over to where Tal was pointing. Racing down from the other side of the escarpment, which lay a few metres away from a newly arrived beach scene complete with seagulls, waders and the occasional heron, was a human figure. He seemed to be making for the reservation/space combination.
“What’s he doing?” asked Theman.
“He’s trying to get out The Quick Way,” answered Tal.
“Over there behind that space and central reservation thing is an opening out of here. Nobody’s made it yet, but people keep trying.”
It was as if every animal out there had been put on emergency alert. Theman had seen a similar thing with the way shoals of fish and flocks of birds move together collectively. When one goes, they all go and when they all go, one goes. The animals below seemed to be acting in exactly the same way but on this occasion, they were all going for one thing; the running human.
“He’s doing pretty well.”
He was already halfway across the landscape and none of the animals were that close to him yet. Hyenas, the gorilla, elephants, lions, monkeys, snakes, a polar bear, dogs, bears, cats were all centripetalling towards the man, as if he were the plug in a huge container and the animals were the water draining away. The lions were the closest, but they were still a long way behind him.
“If he keeps going at that speed, it looks as if he could make it. He must have just caught them all at the furthest point away from where he started. Go on!”
Tal roared his support across the scene.
It really did look as if he was going to make it. He was only about a hundred metres away from the edge of the piece of space and the lions were still a long way behind him.
“Come on, come on! You can do it! Come on! Keep going!”
Tal now had his hands in the air, shaking his fists towards the sprinting figure, who had passed the space and the reservation and was moving towards where the exit was.
“He’s almost there. It’s only about another fifty metres.”
Tal could hardly contain himself.
It was Theman who saw it first. Just a hint of grey out of the corner of his eye and the movement of dust. It must have been behind part of the reservation. That was the only explanation that he could come to when he thought about it later on. It moved so fast. One second the man was there victorious and free; the next he was dead, torn to pieces on the ground.
The rhino just clipped him on the first pass. It was enough. The man fell, tumbling over the dusty ground. Before he had time to get up, the rhino had turned around, thundered back and taken him, with his horn, right up his anus and intestines in one wild swipe. It tore the man in two. The other animals started to arrive at the scene of the killing. First the lions and then the elephants and then gradually the rest gathered around their victim. Somehow the rhino had managed to impale the man’s head on the end of his horn and was now nonchalantly tossing his own head from side to side arrogantly showing the others his prize. This for the majority was going unnoticed. They were far too intent on ripping what was left of the rest of the figure on the floor to pieces.
Back in the hotel room things had changed. No bed, no cabinet, no chest of drawers, no mirror. A motorbike though. A motorbike up on its centre stand with half its engine in a beige washing up bowl bathed in oil. One wheel off and the saddle propped up on the wall next to it. Assorted tools, an open suitcase surrounded by various items ranging from a battery charger to a set of synchronised swimming badges to a local management personnel portfolio. All around the room was scattered what looked like dirty laundry and the remains of numerous half eaten dinners, most of them still steaming on their plates.
The instructions to Theman from Tal were short and simple.
“Eat all the dinners and keep them down, put the bike together, pack the suitcase and get both of them and yourself out of that exit you saw up opposite the glass door.”
Tal turned away and walked towards the door.
“It’s in your hands now. I wish you the best of luck. We’ll do all we can out there to help but the rules are the bike, the suitcase, the dinners. It’s all got to be just you. We can’t get involved in that. Good luck.”
The door slammed closed behind him.
Theman stared at the scene in front of him.
He walked over to the first plate.
There wasn’t much of it left but what was there was startling. Congealed pig’s liver coated in what looked like a chocolate sauce served with the remains of a burnt vegetable pizza. It was still hot. He looked over to the next plate. Untouched chicken dripping in a knickerbockerglory glass, surrounded by a couple of half-eaten peach flans filled with a thick sherbert and mushy pea paste.
He walked over to a cluster of plates by the motorbike. An unfinished portion of lemon meringue pie laid on a bed of tuna and salmon fish paste, a raw sausage sandwich spread with a honey and cod roe mix and a lamb and coffee ice cream stir fry complete with individual lumps of deep fried kidney in a chilli and sugar bean batter.
The plates by the window were even more ridiculous. An under cooked fried egg swimming in a watery, brandy butter and liquorice puree surrounded by heaps of marzipan coated chick peas, a treacle and cabbage doughnut perched on a pile of jelly from inside a pork pie, a bowl of cold vegetable soup sprinkled with a thick layer of hundreds and thousands and laid with slices of tofu and icing bake and a large serving dish full of trout, stuffed with pork scratchings and jelly beans cooked in a cream soda and parmesan sauce.
“Oh, by the way.”
Tal had stuck his head back around the door.
“When you do come out with the bike and the case, you’ve got to do it in one go. Both of them together. You only get one chance.”
Theman didn’t even bother asking what would happen if he didn’t make it. He knew everything had gone past that point now. No logic in The It. Just things as they are.
He nodded and turned back to the food, wondering how he was even going to start on it, let alone finish it all and keep it down in his stomach.
Then the thought appeared.
Mashed potato with Aunt Jill and Uncle Derek.
Theman allowed it to fill out from its centre. Himself, his brother as a baby, his mother and his stepfather. Around a dining table. A lump of meat in a washy gravy on a plate in front of him. The potato laid by it, starting to get cold. Lumps and hard eyes that hadn’t been mashed properly; tails of flaky stringy strands that were just there designed to tangle and gag in Theman’s throat.
Mother and stepfather through clenched teeth when not really proper aunt and uncle are starting to clear away.
“Eat it now. You’re not getting down until it’s finished.”
Theman, hot and contracted. Gullet feels like it has the width of a drinking straw. Hostile, accusing shaking head faces of tormentors. One conciliatory forkful. The texture of crumbling past its sell by date. Expanding cheeks, each contact with an inside membrane sending alarm messages to the churning stomach which five minutes later had emptied itself into Aunty Jill’s upstairs toilet.
In bed that night Theman awoke, squashed between his mother and stepfather, screaming 2I’m blind.I can’t see anything.” And so his mashed potato phobia had begun. From that point onwards, not at any time at all, would Theman ever again be able to enjoy mashed potato or any of its associated forms.
Gradually, as he grew older, he did develop strategies to protect himself from the dreadful vegetable. He had to. An incident in his early teenage years saw to that. He was on one of those long monotonous car journeys off to see a distant aunt. They’d had delays through traffic jams and having to keep stopping because of his brother’s car sickness and they were getting on for a couple of hours late. When they finally did arrive, they were greeted with the usual kisses and hugs, the brief exchange of stories and the ‘You must be famished. We’ve kept something warm in the oven.’
Theman just knew what was going to happen. It was almost as if the potato from Aunty Jill’s table in the past had jumped in its car and had followed him up the motorway. He knew that somehow it had parked up at the end of the road and had climbed over three or four garden fences and sneaked itself in through the backdoor of his aunt’s house and jumped into the oven onto the plate ready for him when he came in. And sure enough there it was in front of him. He didn’t even notice what there was with it. All he could see were the two huge semi-warm monstrosities lying wallowing and heaving on the china.
“There are more potatoes if you want them.”
His aunt was so eager to please.
Everyone started to tuck in.
Theman cut into one of them. The outside surface crumbled away revealing a large core of undercooked centre which pushed back against his slicing knife. It was his worst possible scenario. The two extremes in one potato. Neither of them had the possibility of staying down. The hard centre would slip onto his tongue, angular and not ready to eat. It would hold itself in there, outstretched arms at the back of his tongue; two to keep itself in the mouth and two to slide down to his stomach to call the contents up if by any miracle it did manage to get down there.
He knew the earth, musty sock outside wouldn’t be much better. It would disintegrate onto his tongue in a mush and, although it could slide easily away, it wouldn’t. It would cement up in the back top part of his throat, the gag retch part and it wouldn’t go. It would just poultice there waiting for the moment when it could come back out.
Theman started on the vegetables and meat that were with the potatoes, desperately trying to give himself some time to think what he was going to do. He already knew, however, that there was really only one option. He was going to have to eat them or at least one of them. If he managed to disappear half of the revolting mass down his throat then maybe he could hide the rest in his gravy, or at least amongst a few vegetables that he could leave scattered over the plate.
He cut a section off and pushed it into his mouth. No possible way. It was only in there for about two seconds before he brought it straight back up again into his hand. The unfortunate thing for Theman was that this action was accompanied by a rasping swine snort sound that honked up from his throat across the table, bringing everybody’s meal to a standstill. He just managed to mutter something about not feeling very well before he jumped up from the table and brought up the rest of his dinner into the kitchen sink.
After this watershed incident in his potato life Theman realised that something had to be done. He just had to have route ways out of any situation involving one of these monstrosities of nature. If he knew he was visiting somebody who had the potential of serving up big dollops of the stuff, he realised he had a number of alternatives. If he was in the right frame of mind, he could just leave it on the plate, be questioned with "don’t you like mashed potato then?" and then just smile and tell them the story from his childhood. If however, he wasn’t and it was really somebody he didn’t want to offend then there was something else he could do.
He’d discovered it years ago whilst visiting a particularly close school friend. They’d been watching football together on television and generally just washing away a Saturday afternoon. Then the fateful words:
“Why don’t you stay for dinner? My mum’s cooking one of her specials.”
Theman had that same feeling of impending doom that he had felt as he stood at the door of his aunt’s house.
“They’re going to be there,” he thought. “In the dish waiting. They know I’m here. They’re back to torment me. What am I going to do?”
Theman started desperately trying to find a solution. He couldn’t let his friend down, but he also couldn’t eat the horror that was going to be put in front of him. Although he was very close to his friend and they had already shared a great deal of home truths, it was another matter when it involved actually offending his parents by refusing their food. He just couldn’t see the possibility of him sitting there, a guest, turning to his friend’s mum and dad, in front of his friend’s sister, who he quite fancied as well, and being able to say ‘I really don’t like mashed potato. Could you please not give me any.’ It was just an impossibility. He had to come up with something else. And he did.
It was all inevitable. Not only was it the mum and dad and the sister but there was also an uncle and aunt and one of the sister’s friends. The table had been carefully laid, as if for a very special occasion, and the lack of space left on it made it apparent to Theman that there would be no serving dishes and therefore that everything would be dished up directly in front of him on his plate including, he should imagine, a large helping of potato of some form. There could be no escape. And so it was.
A generous portion of delicious smelling goulash with a spicy, cucumber salad and a steaming, creeping. engulfing pile of mashed potato.
“There’s more spuds if you want them.”
A cry to the masses. Always eager to please.
Theman sat and stared at his adversary on the plate.
And then he just did it. He didn’t know where the idea came from but he simply went ahead and just did it. He used the fact that the goulash was so strong in its flavours and smelt so wonderful. The fact that it acted as a balance to the insipid lifelessness of the pile of mess he had to work his way through that lay cowering in the corner of his plate. The fact that he could not possibly embarrass his friend and the fact that he was totally sick to death of bowing down to the power of the all-encompassing potato. He just did it. One mouthful of goulash and then a quick mouthful of potato. A quick swallow and it was gone. Admittedly it was annoying that he couldn’t enjoy what was a magnificent goulash, but it was worth it to be able to clear the plate eventually of the whole pile of mashed potato and to be in the position of saying ‘That was lovely. No. No. Really. Thank you. I’ve had enough. I’m completely full.”
It was as simple as that. Another food put in at the right time, that had the strength of character to do it, could negate the effect of the potato. And this is what the message he had received in the hotel room had been all about.
“Mashed potato with Aunty Jill and Uncle Derek.”
The cloaking of food using another food. The idea shone in his face as he looked at the array of dinners in front of him.
“Where is it then? Where’s the cloaker? Where’s the thing that’s going to take the role of the goulash?”
“Under the bowl with the engine in,” said the message on the piece of paper, that was attached to the end of the branch, that was tapping on the window opposite.
“Thank you very much,” said Theman, as he gave a deep bow to his old friend, The Tree That Grows Out Of Ex-Roads. He was almost starting to enjoy himself. He walked over to the motorbike and lifted up one edge of the bowl containing the engine. It wasn’t that easy. Firstly, because it was heavy and secondly because the outside of the plastic bowl was covered in a thin film of oil which made it very difficult to get a good grip. He grabbed the nearby wheel, that had been taken off of the motorbike and jammed enough of it under the bowl to wedge it up so he could have a look underneath.
A plate of squashed toast. That was it. He pulled it out and let the bowl slowly back down onto the floor. He counted sixteen slices and, although they were slightly soiled with motor oil, they were still edible.
“But this won’t do as a cloaker. There must be something else. What is it?”
He looked over to the window for some more help.
“You can have it on toast sometimes with eggs
You can have it as a hot drink when you’re ill in bed
It’s a joy in front of football on crackers at night
And the doctors even say it helps your sight.”
The message this time was neon stripped across the whole top of the tree, flashing like a huge Christmas decoration.
“So, I need to find some Thick, Yeasty, Dark brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes. Is that it? Put it on the toast and there’s my cloaker?”
He stood and thought about it for a few moments, staring at the huge pulsating sign in front of him.
“Don’t think too long” sidled in and reminded him of where he was and how things worked there. He knew he just needed to act on impulse. Jump with an idea. To linger for an excessive period of time resulted in roots. And most definitely, roots, at this particular moment, did not seem to work in The It.
“Ok where are you my little beauty? Come out wherever you are! Don’t be scared. I'm not going to hurt you.”
Down on his hands and knees, Theman looked and sounded as if he was searching for a lost kitten rather than a jar of missing Thick, Yeasty, Dark Brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes.
“Come to daddy. There’s a good little jar. Daddy only wants to eat you. That’s all. Come on then.”
He tried amongst the dinners again, around the motorbike and everywhere he could think of in the room but no Thick, Yeasty, Dark Brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes. The cupboards, behind the curtains, even inside the petrol tank. Nothing.
But the help was there at hand as it always is if you allow yourself to see it. The spinning image of a skirting board hovered in front of Theman as he crawled around the floor. Simply that. A white painted piece of wood running along the foot of a wall catapulted into his mind and rotated there for a few moments before it moved off to be replaced by an almost recognisable street corner scene. He’d started to learn. He leapt up and hurried over to the skirting that ran below the window. It seemed as good a place as any to start. He knelt down and examined the top of it carefully. Running all the way along where the wood met the wall was a pencil lead thin trail of Thick, Yeasty, Dark Brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes. He followed it. It went right around the room. Not only that. All the window frames and the door frames also had it. It even ran around the edges of the panels that were on the back of the door that led to the chute.
The next thirty-two minutes were scripted. Just like a lot of things are. Certain occasions, conversations, incidents seem to happen exactly as you would imagine them happening. Almost to the point of being a cliché. Things seem to fit together. Marry up. March on hand in hand. Everything moves smoothly and is unified. All is true. There are no angles or edges to trip over. Only a gentle gradient down to the inevitable. There also seems to be a definite relationship between the starting point and the finishing point. Almost as if they are the same. As soon as one of these chains of events starts to happen there is only one possible result. The finish. This process, call it fate, ordained happenings, a feeling in your water or bones or whatever, is unstoppable. It is. Simply that. Of course. The Thick, Yeasty, Dark Brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes, that he found around the room, was exactly the right amount to spread on sixteen slices of toast. Of course, sixteen slices of toast gave just enough cloakers to cope with all the dinners. Of course, the piece of engine, that lay in the washing up bowl, was familiar to Theman and slipped right back into position on the motorbike without any problem at all. The wheel followed quickly.
Of course, the suitcase was just the right size for all the clothes that were scattered around the room.
“One bike complete. Suitcase full. Dinners all eaten and kept down.”
Theman stood by the door deciding what to do next. He knew that the script had ended for the moment and that that feeling of pre-destiny or inevitability had left him for the time being. Whatever was facing him on the other side of the door was to be confronted in the raw. He had decisions to make, and he knew that anything that happened to him out there would be related to his centre and his actions. The external events may differ, but he was aware that there would be no softening of the parameters or easy movements down this time. The It would operate and he would have to react. What was going to happen would depend on this.
He had a plan. The motorbike was light enough to lever up on the edge of the chute. He’d do this and then bring the suitcase up on top of it. He’d found a piece of old rope that he’d cut in half. One section he would use to tie the suitcase onto the bike and the other he would tie around the handlebars and use it as a tow rope to pull the whole lot up to the door at the top. When he was there, he planned to push the suitcase through and then he would spend the rest of the time getting the angles right on the bike. Probably starting with feeding the front wheel through and then twisting the rest to follow.
Theman knew that the plan was just theory and that everything would change when he was out there. The animals were after him and the very nature of The It seemed to be impermanence itself. However, he needed something to work from and the plan was that. It would give him some form of foundation, if anything of the sort existed in the place. A start, a core and hopefully a finish.
He opened the door. Things had changed! The chute was there exactly as it had been before, but the brick wall opposite had been replaced. It was now panel after panel of plain glass, giving what would have been a clear view of the back of the slope they had walked behind outside earlier. ‘Would have been’ because the view was blocked. Along the whole length, for as far as he could see up and down, were the animals from outside. They were standing, sitting, leaning on the other side of the glass, looking in directly to where Theman’s hotel room door was. There was no sound from them and they all appeared expressionless as they stared in at the chute. There was little movement other than the occasional scratch or sneeze. They all seemed totally fixed on what was going on inside, as if they were waiting for something to happen.
This was peculiar enough, but it was nothing compared to what the animals were holding. Each of them, without exception, had some form of placard or banner. Small handheld ones, only the size of a medium television screen; long unwound ones written onto huge equatorial leaves with an animal at either end. Complicated designs; simple ones written onto towering sheets of paper that needed support at the top from birds or monkeys. The whole length of glass was covered from top to bottom with messages pressed against it:
“YOU'RE GOING TO DIE SOON.”
“THINK OF LIVER WITH CHOCOLATE.”
“NOT LONG LEFT NOW.”
“WE CAN SMELL YOUR BLOOD.”
“GAG ON A POTATO.”
“DEATH IN THIS PLACE NEVER ENDS.”
Each of the banners had a most personal message for Theman. He slammed the door shut. Tal immediately opened it and stuck his head around the corner.
“Before you ask. I know nothing about this. It’s what happens around here. One minute the bricks and then........ that lot!”
Theman just stared at him, not saying a word.
“Since they’ve been there though we haven’t had one visitation inside. They all seem to be out there waiting for something to happen in here. It’s almost as if they know what you’ve got to do and they’re waiting for you to start. It does seem a good time to try and make the move.”
Tal glanced down at the bike and suitcase by the door.
“You didn’t hang about with that did you?”
Theman nodded at him.
“Are the lookouts still up there in case any of them do choose to come inside suddenly?”
"Yes sure. Everything on our side is as it was before. We’re making every effort to keep the chute as clear as possible for your run. We can do that but I’m afraid any other help is out of the question. We can’t give you a hand with lifting or anything like that.”
Theman walked up to the door and looked out again. The scene was exactly the same. An ominous stillness lay over the animals.
“What do they want?”
Theman knew the answer before he’d even finished asking.
“Why me though? What have I done?”
Martyrdom was a new one for Theman but the heavy pressure of it suddenly lay stagnant in his mind. The earlier light of acceptance, that had softened its way into his thoughts, had now been extinguished by the thick mud of a cause. He suddenly felt persecuted, rejected but at the same time chosen as a willing victim, a sacrifice. He felt as if he was a representative. Of who he didn’t know. However he did feel that he had a responsibility on his shoulders to suffer. Although that sense of inevitability, from when he had discovered the Thick, Yeasty, Dark Brown, Savoury Spread That Is Generally Only Available In The United Kingdom, South Africa And The Antipodes trail, had disappeared, he could sense the seed of a new strand starting to germinate. The feeling that he was moving towards a new found nadir come zenith, being pulled to it and pulling to it, helping himself to a newly opened pot of sickly sweet suffering. Oh to choke on it! To be suffocated by its incessant perfume of failure and sin and the constant grinding wheel of guilt.
Theman lifted the bike up, balancing it on one tyre, ready to lever it all the way onto the chute. He looked across at Tal who had returned to his place on a small podium that was built out of the wall, just above the chute to the left of Theman’s hotel room door.
“I'm ready.”
His speech was languid and resigned.
“Don’t forget the spare.”
Tal pointed across at another wheel for the motorbike that had just rolled into the centre of the room, spun for a few seconds and then come to rest on the floor. Theman hardly gave it a second look.
“That’s got to go as well, I suppose?”
Tal nodded.
Theman left the bike propped up against the chute and walked over to get the spare wheel.
“Can I make a suggestion?”
Tal popped his head around the door again.
“You’ve got your hands full with the bike and the suitcase. Why don’t you use the wire cutters in the toolbox to cut away the spokes on the spare? Then you can wear it on your head and your hands will still be free. That way you should be able to manage it all at the same time.”
Theman didn’t answer but just went over to the toolbox and did exactly what Tal had suggested. After a few moments of cutting and bending, he was back at the door in his new headwear, his face still set in an expression of dull resignation.
“I'm ready.”
This time there was no interruption from Tal. The bike went up quite easily and, because the gradient of the chute wasn’t that extreme, after sliding down a few inches, it found a position that appeared to be fairly stable. Theman gave it a push. It seemed to be jammed quite securely between the glass on the opposite side and the brick wall that ran along next to the hotel room door. He jumped back down into the room and grabbed the suitcase. He pushed it up onto the chute and quickly followed it up himself so that he was crouched down by the bike, with the suitcase lying next to him.
“Great start.”
Tall looked across at Theman from his position on the podium.
“Now just ignore them. Get that rope round it and you’ll be up and out before you know it.”
The second part of the instruction was easy. Theman took the rope, that he had already cut into two sections, from around his waist and tied one of them to the suitcase and strapped it around the bike. He attached the other to the handlebars and trailed it up the slope ready to start The Pull. But the first part. Ignore the animals! How could he? Their static poses had taken on a new perspective since the concrete martyr had set into his soul. It was no longer just the messages that were threatening. It was everything about the beasts. Their impassive expressions were still there but there was a screaming hatred about them now that cut hard into Theman’s bone stomach throat network.
No movement, no sound but dark, dark hollows for eyes that could barely contain the poison that was spitting towards him from their stares. And it continued all the way up the chute. Every animal cursed Theman. Their intransigent empty faces slamming their message through the glass splintering into his pores, slicing into his bone, flattening into his tendons. He felt their collective fury bearing down on him, cupping inside his skull, forcing him outwards and into their dismembering silence.
Tal shouted up to the two men on the brow of the chute. To Theman now they seemed tiny unreachable figures standing in a world that was nothing to do with his.
“All clear ?”
Tal got the signal.
“Go. You're going to do it. Just put them out of your mind and pull it........... u................................p t.....h.....e.........r...................e. Y.................................................................................................o............. ............................................u......’................................ll............................ ............b....................................................e...............................f............... ...............................................................i................................................... .....n...........................................................e....................G......................... ..........................................................................................................o....... ............................................o..................................................................n.”
Everything was slowing down for Theman now, as if he was at the centre and the externals were circling through treacle that got thicker and thicker as it slid in towards him. Tal’s last few words hung in the air, suspended there like peppercorns floating in a sea of olive oil. He turned and looked across at the animals. Their movement before had been minimal. Now it was almost non-existent. The occasional turn of the head to look up the chute or a scratch had become gargantuan epic events. Muscles pulley tight rotate. Almost mechanical. Heads bathed in drifting breathe in a linked sequence smooth in their turn, decelerating like spherical monoliths rolling in an arc around a grinding core.
Theman started his climb. The weight of his load was not much of a problem physically but the heavy drag of the dark cavity of doom was. He inched his way up fighting against the desire to retch out a scream. The blinking eyes of the animals slowed down now to aperture slides. Whites gone and then back again, gleaming moist from their caves with topped up hatred. As he moved on, a new set was always there ready to greet him with another penetration of loathing.
Something was trickling down the side of his face. He stopped and with his free hand felt up for it and brought it down to look. It was blood. Without realising it, Theman had been dragging the tyre that was on his head against the surface of the chute and the cut off spokes had been digging into his temples.
The animals sensed its presence immediately. As he continued up, he noticed an animation around their mouths. Still incredibly slow but the top lip of some of the animals had started to snarl back and curl up over itself. The bared gums of a small gibbon showed through the glass as a shiny offering; the tongue of a wolf laid heavy pink slop over its hairy chin; the teeth of a weasel, jaw tight hook up time.
They were ready for the taste of the climbing martyr. The silent howl of the blood brigade passed through the glass and capsized over Theman, washing him with their burning hate. He felt the tremendous pressure of their fury beating down on him, forcing him heavy into the chute. An enormous weight. A beast's hand sliding in between the skin of his head and his skull and squeezing to crush, to crack, to destroy.
His journey upwards continued. The penance of a sinful slave on an eternal gradient. He inched up. The weight of the motorcycle and the suitcase now starting to tell and mingling well with his ever increasing internal problems. The essence of the animals was beginning to get inside. No movement, no sound, no outside expression but the potential of their cauldron of hatred was immense. To Theman, it felt as if he had already been struck down, ripped to pieces and devoured. That had happened. It was the easy part. The physical. Now he was in penetration by thousands of years of feral being. Their stares, their stance, their presence, their intention seeped inside Theman and, like a poison, started to work from within. It was a lethal cocktail. This and his desire for his own destruction. The deep-rooted need to be annihilated. Way past the sexual, way past the parents, far away from the hero. He was moving in towards something or somewhere unobtainable. By its nature a paradox. At the core of his suffering was a soft, a soft that had lightness that fed the suffering and made it grow. Without the soft the suffering would not exist. But the soft was also hard like a chocolate ball with a metal heart. So where is the centre and where does it end and if it does end, why does it end?
Anyway, Theman nearly reached the brow of the chute despite the livid intentions of his animal friends but he didn't quite make it. The lookouts were late spotting them and by the time they had, they were too close. The rhinos! One next to the other. Over the brow they thundered. Spinning motorcycle and open suitcase sliding down the chute.
“Back to self-destruction Theman? Why? Is this part all of us? A need not to exist? Is something taking us back to where we were before we did?”
The Welcoming Man stood Colossus at the top of the chute holding Theman’s limp body high above his head.
“Has this helped you understand?”
He pinned the body butterfly beautiful to wood and scalpel incision removal ready for boiling made in acid dipped to dissolve and cleanse head bent over carrion feeding reduction to basic elemental test tube Theman liquid to gas evaporate.
The Welcoming Man wafted and blew
and away Theman flew
in a drift to a cloud
A rebirth that works and a life that won’t hurt
And it all will start with sprinkle of rain
That will scatter Theman with the minimum of pain
And so he fell as a drop of water from the cloud
And landed with little disturbance on the ground
he found himself Theman body again
and wandered to a wood where he began
to introduce himself to a local man
who filled him with the spirit of nature’s best plans
“I’m going to Field why don’t you come?
This year’s going to be a magical one”
The man waved his hand in that direction once more
And Theman found himself amongst friends by the score
“I believe in myself at long last,” he declared
“I know where I’m going, I’m fully aware
Of what I’ve become and where I should go
I am the person to which I will grow.”
And The Field that year was the best that had been
Such dancing and drinking had never been seen
And as for the music
It filled all the air
with rhythms and melodies
these moments to share
between all the village folk and Theman was there
these moments to share
Theman was there.
When the day gave away itself to the night
The valley grew quiet as they put out the lights
Of the scatter of cottages
Sleep found its way
Past the breeze moving curtains
In their beds as they lay
In his bed as he lay at the end of his day
Theman waited for his dreams to come and play
And they did come and play in their mercurial way.
From arenas of lore
To the forgotten core
Theman lay soft at the opening door
A wishing well came full of outstretched arms
Holding hands of people he’d known
The hands were all joined in a circle of light
From which a tree had grown
And in that tree danced a madrigal monk
Who laughed and banged his drum
And threw with the rhythm he’d made with his skin
A seed up towards the sun
But the seed fell deep back to the earth
With womb intent to bathe
And burrowed between the clods and roots
And made a chamber safe
A fertilisation took place in this seed
The coming together of distances
A movement towards germinating belief
A creation that Theman witnesses
Of such universal truth and being
Of new life unravelling
A bursting out of harmonious love
Preconditions unshackling
And up he grew a stem of corn from the earth
Stretching to the sky a Theman rebirth
To be taken by the cut of a blade in the sun
The tractor yangman had begun
The movement of Theman to a cereal bowl
Back at the table at the moment she stole
That question!
“What’s the matter darling you don’t seem yourself?”
Theman lifted his spoon and ate himself
He chewed and swallowed and pondered a reply
And a peculiar look came into his eye.